ID: 935120316

View in Genome Browser
Species Human (GRCh38)
Location 2:100178395-100178417
Sequence GGGTGGGCCAATGCAAATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935120316_935120322 3 Left 935120316 2:100178395-100178417 CCTTGATTTGCATTGGCCCACCC No data
Right 935120322 2:100178421-100178443 AATTTGCATATAATTGAAAGTGG No data
935120316_935120323 4 Left 935120316 2:100178395-100178417 CCTTGATTTGCATTGGCCCACCC No data
Right 935120323 2:100178422-100178444 ATTTGCATATAATTGAAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935120316 Original CRISPR GGGTGGGCCAATGCAAATCA AGG (reversed) Intergenic