ID: 935120316 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:100178395-100178417 |
Sequence | GGGTGGGCCAATGCAAATCA AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
935120316_935120322 | 3 | Left | 935120316 | 2:100178395-100178417 | CCTTGATTTGCATTGGCCCACCC | No data | ||
Right | 935120322 | 2:100178421-100178443 | AATTTGCATATAATTGAAAGTGG | No data | ||||
935120316_935120323 | 4 | Left | 935120316 | 2:100178395-100178417 | CCTTGATTTGCATTGGCCCACCC | No data | ||
Right | 935120323 | 2:100178422-100178444 | ATTTGCATATAATTGAAAGTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
935120316 | Original CRISPR | GGGTGGGCCAATGCAAATCA AGG (reversed) | Intergenic | ||