ID: 935120316

View in Genome Browser
Species Human (GRCh38)
Location 2:100178395-100178417
Sequence GGGTGGGCCAATGCAAATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935120316_935120323 4 Left 935120316 2:100178395-100178417 CCTTGATTTGCATTGGCCCACCC No data
Right 935120323 2:100178422-100178444 ATTTGCATATAATTGAAAGTGGG 0: 6
1: 92
2: 218
3: 222
4: 650
935120316_935120322 3 Left 935120316 2:100178395-100178417 CCTTGATTTGCATTGGCCCACCC No data
Right 935120322 2:100178421-100178443 AATTTGCATATAATTGAAAGTGG 0: 6
1: 93
2: 205
3: 247
4: 708

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935120316 Original CRISPR GGGTGGGCCAATGCAAATCA AGG (reversed) Intergenic
No off target data available for this crispr