ID: 935121747

View in Genome Browser
Species Human (GRCh38)
Location 2:100189101-100189123
Sequence ACATTCCCACCCATAGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935121742_935121747 -2 Left 935121742 2:100189080-100189102 CCACACTGGCTGCCCCATTTTAC No data
Right 935121747 2:100189101-100189123 ACATTCCCACCCATAGTGCAGGG No data
935121741_935121747 9 Left 935121741 2:100189069-100189091 CCTACTGTTTTCCACACTGGCTG 0: 2
1: 9
2: 113
3: 361
4: 769
Right 935121747 2:100189101-100189123 ACATTCCCACCCATAGTGCAGGG No data
935121740_935121747 10 Left 935121740 2:100189068-100189090 CCCTACTGTTTTCCACACTGGCT No data
Right 935121747 2:100189101-100189123 ACATTCCCACCCATAGTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935121747 Original CRISPR ACATTCCCACCCATAGTGCA GGG Intergenic
No off target data available for this crispr