ID: 935121839

View in Genome Browser
Species Human (GRCh38)
Location 2:100189935-100189957
Sequence TCATGTGACTCCAGGAGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935121839_935121851 23 Left 935121839 2:100189935-100189957 CCTTTCCTCCTGGAGTCACATGA No data
Right 935121851 2:100189981-100190003 ACAGGTGGAGAAGGTACACTGGG No data
935121839_935121850 22 Left 935121839 2:100189935-100189957 CCTTTCCTCCTGGAGTCACATGA No data
Right 935121850 2:100189980-100190002 AACAGGTGGAGAAGGTACACTGG No data
935121839_935121847 14 Left 935121839 2:100189935-100189957 CCTTTCCTCCTGGAGTCACATGA No data
Right 935121847 2:100189972-100189994 GCTGTCCCAACAGGTGGAGAAGG No data
935121839_935121846 8 Left 935121839 2:100189935-100189957 CCTTTCCTCCTGGAGTCACATGA No data
Right 935121846 2:100189966-100189988 AGCAGTGCTGTCCCAACAGGTGG No data
935121839_935121845 5 Left 935121839 2:100189935-100189957 CCTTTCCTCCTGGAGTCACATGA No data
Right 935121845 2:100189963-100189985 GGTAGCAGTGCTGTCCCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935121839 Original CRISPR TCATGTGACTCCAGGAGGAA AGG (reversed) Intergenic
No off target data available for this crispr