ID: 935121844

View in Genome Browser
Species Human (GRCh38)
Location 2:100189943-100189965
Sequence ACCCCTGCTCATGTGACTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935121844_935121851 15 Left 935121844 2:100189943-100189965 CCTGGAGTCACATGAGCAGGGGT No data
Right 935121851 2:100189981-100190003 ACAGGTGGAGAAGGTACACTGGG No data
935121844_935121845 -3 Left 935121844 2:100189943-100189965 CCTGGAGTCACATGAGCAGGGGT No data
Right 935121845 2:100189963-100189985 GGTAGCAGTGCTGTCCCAACAGG No data
935121844_935121846 0 Left 935121844 2:100189943-100189965 CCTGGAGTCACATGAGCAGGGGT No data
Right 935121846 2:100189966-100189988 AGCAGTGCTGTCCCAACAGGTGG No data
935121844_935121853 27 Left 935121844 2:100189943-100189965 CCTGGAGTCACATGAGCAGGGGT No data
Right 935121853 2:100189993-100190015 GGTACACTGGGTGACCTGCAGGG No data
935121844_935121847 6 Left 935121844 2:100189943-100189965 CCTGGAGTCACATGAGCAGGGGT No data
Right 935121847 2:100189972-100189994 GCTGTCCCAACAGGTGGAGAAGG No data
935121844_935121852 26 Left 935121844 2:100189943-100189965 CCTGGAGTCACATGAGCAGGGGT No data
Right 935121852 2:100189992-100190014 AGGTACACTGGGTGACCTGCAGG No data
935121844_935121850 14 Left 935121844 2:100189943-100189965 CCTGGAGTCACATGAGCAGGGGT No data
Right 935121850 2:100189980-100190002 AACAGGTGGAGAAGGTACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935121844 Original CRISPR ACCCCTGCTCATGTGACTCC AGG (reversed) Intergenic
No off target data available for this crispr