ID: 935121846

View in Genome Browser
Species Human (GRCh38)
Location 2:100189966-100189988
Sequence AGCAGTGCTGTCCCAACAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935121844_935121846 0 Left 935121844 2:100189943-100189965 CCTGGAGTCACATGAGCAGGGGT No data
Right 935121846 2:100189966-100189988 AGCAGTGCTGTCCCAACAGGTGG No data
935121840_935121846 3 Left 935121840 2:100189940-100189962 CCTCCTGGAGTCACATGAGCAGG No data
Right 935121846 2:100189966-100189988 AGCAGTGCTGTCCCAACAGGTGG No data
935121839_935121846 8 Left 935121839 2:100189935-100189957 CCTTTCCTCCTGGAGTCACATGA No data
Right 935121846 2:100189966-100189988 AGCAGTGCTGTCCCAACAGGTGG No data
935121837_935121846 10 Left 935121837 2:100189933-100189955 CCCCTTTCCTCCTGGAGTCACAT No data
Right 935121846 2:100189966-100189988 AGCAGTGCTGTCCCAACAGGTGG No data
935121838_935121846 9 Left 935121838 2:100189934-100189956 CCCTTTCCTCCTGGAGTCACATG No data
Right 935121846 2:100189966-100189988 AGCAGTGCTGTCCCAACAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935121846 Original CRISPR AGCAGTGCTGTCCCAACAGG TGG Intergenic
No off target data available for this crispr