ID: 935124126

View in Genome Browser
Species Human (GRCh38)
Location 2:100207898-100207920
Sequence CTTCTTATCAGACATGTGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935124126_935124128 18 Left 935124126 2:100207898-100207920 CCACGCACATGTCTGATAAGAAG No data
Right 935124128 2:100207939-100207961 CCAGAGTCAATATTAAGTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935124126 Original CRISPR CTTCTTATCAGACATGTGCG TGG (reversed) Intergenic
No off target data available for this crispr