ID: 935124893

View in Genome Browser
Species Human (GRCh38)
Location 2:100214635-100214657
Sequence CACCGCAATCCTGGGAACGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935124893_935124902 14 Left 935124893 2:100214635-100214657 CCTGCGTTCCCAGGATTGCGGTG No data
Right 935124902 2:100214672-100214694 CCCCTACCCCATCCCATCCCTGG No data
935124893_935124904 15 Left 935124893 2:100214635-100214657 CCTGCGTTCCCAGGATTGCGGTG No data
Right 935124904 2:100214673-100214695 CCCTACCCCATCCCATCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935124893 Original CRISPR CACCGCAATCCTGGGAACGC AGG (reversed) Intergenic
No off target data available for this crispr