ID: 935126075

View in Genome Browser
Species Human (GRCh38)
Location 2:100223991-100224013
Sequence CTGTGAAGTGGGCAGTTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935126075_935126081 -6 Left 935126075 2:100223991-100224013 CCCACCAACTGCCCACTTCACAG No data
Right 935126081 2:100224008-100224030 TCACAGCTGCCCTTGGCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935126075 Original CRISPR CTGTGAAGTGGGCAGTTGGT GGG (reversed) Intergenic
No off target data available for this crispr