ID: 935128423

View in Genome Browser
Species Human (GRCh38)
Location 2:100243434-100243456
Sequence CTTGAGGTCTAAGAATGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935128423_935128428 24 Left 935128423 2:100243434-100243456 CCCACACATTCTTAGACCTCAAG No data
Right 935128428 2:100243481-100243503 TAAATCAGCACAGAGTAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935128423 Original CRISPR CTTGAGGTCTAAGAATGTGT GGG (reversed) Intergenic