ID: 935128424

View in Genome Browser
Species Human (GRCh38)
Location 2:100243435-100243457
Sequence CCTTGAGGTCTAAGAATGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935128424_935128428 23 Left 935128424 2:100243435-100243457 CCACACATTCTTAGACCTCAAGG No data
Right 935128428 2:100243481-100243503 TAAATCAGCACAGAGTAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935128424 Original CRISPR CCTTGAGGTCTAAGAATGTG TGG (reversed) Intergenic