ID: 935128424 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:100243435-100243457 |
Sequence | CCTTGAGGTCTAAGAATGTG TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
935128424_935128428 | 23 | Left | 935128424 | 2:100243435-100243457 | CCACACATTCTTAGACCTCAAGG | No data | ||
Right | 935128428 | 2:100243481-100243503 | TAAATCAGCACAGAGTAAGTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
935128424 | Original CRISPR | CCTTGAGGTCTAAGAATGTG TGG (reversed) | Intergenic | ||