ID: 935128427

View in Genome Browser
Species Human (GRCh38)
Location 2:100243450-100243472
Sequence AAATAAGCATTTCCTCCTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935128427_935128428 8 Left 935128427 2:100243450-100243472 CCTCAAGGAGGAAATGCTTATTT No data
Right 935128428 2:100243481-100243503 TAAATCAGCACAGAGTAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935128427 Original CRISPR AAATAAGCATTTCCTCCTTG AGG (reversed) Intergenic