ID: 935128428

View in Genome Browser
Species Human (GRCh38)
Location 2:100243481-100243503
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935128420_935128428 30 Left 935128420 2:100243428-100243450 CCCAGCCCCACACATTCTTAGAC No data
Right 935128428 2:100243481-100243503 TAAATCAGCACAGAGTAAGTAGG No data
935128422_935128428 25 Left 935128422 2:100243433-100243455 CCCCACACATTCTTAGACCTCAA No data
Right 935128428 2:100243481-100243503 TAAATCAGCACAGAGTAAGTAGG No data
935128424_935128428 23 Left 935128424 2:100243435-100243457 CCACACATTCTTAGACCTCAAGG No data
Right 935128428 2:100243481-100243503 TAAATCAGCACAGAGTAAGTAGG No data
935128423_935128428 24 Left 935128423 2:100243434-100243456 CCCACACATTCTTAGACCTCAAG No data
Right 935128428 2:100243481-100243503 TAAATCAGCACAGAGTAAGTAGG No data
935128421_935128428 29 Left 935128421 2:100243429-100243451 CCAGCCCCACACATTCTTAGACC No data
Right 935128428 2:100243481-100243503 TAAATCAGCACAGAGTAAGTAGG No data
935128427_935128428 8 Left 935128427 2:100243450-100243472 CCTCAAGGAGGAAATGCTTATTT No data
Right 935128428 2:100243481-100243503 TAAATCAGCACAGAGTAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type