ID: 935128457

View in Genome Browser
Species Human (GRCh38)
Location 2:100243768-100243790
Sequence ATCCATCCACAGATGAACCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935128457_935128464 5 Left 935128457 2:100243768-100243790 CCCCGGTTCATCTGTGGATGGAT No data
Right 935128464 2:100243796-100243818 GTCTATCTCTGGGCCGGGCACGG No data
935128457_935128462 -1 Left 935128457 2:100243768-100243790 CCCCGGTTCATCTGTGGATGGAT No data
Right 935128462 2:100243790-100243812 TTAAAAGTCTATCTCTGGGCCGG No data
935128457_935128461 -5 Left 935128457 2:100243768-100243790 CCCCGGTTCATCTGTGGATGGAT No data
Right 935128461 2:100243786-100243808 TGGATTAAAAGTCTATCTCTGGG No data
935128457_935128460 -6 Left 935128457 2:100243768-100243790 CCCCGGTTCATCTGTGGATGGAT No data
Right 935128460 2:100243785-100243807 ATGGATTAAAAGTCTATCTCTGG No data
935128457_935128463 0 Left 935128457 2:100243768-100243790 CCCCGGTTCATCTGTGGATGGAT No data
Right 935128463 2:100243791-100243813 TAAAAGTCTATCTCTGGGCCGGG No data
935128457_935128465 8 Left 935128457 2:100243768-100243790 CCCCGGTTCATCTGTGGATGGAT No data
Right 935128465 2:100243799-100243821 TATCTCTGGGCCGGGCACGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935128457 Original CRISPR ATCCATCCACAGATGAACCG GGG (reversed) Intergenic
No off target data available for this crispr