ID: 935128607

View in Genome Browser
Species Human (GRCh38)
Location 2:100244805-100244827
Sequence AGTTATAGTCAGAGGGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935128601_935128607 -3 Left 935128601 2:100244785-100244807 CCACTCAGGGTTTCTCCCGCAGT No data
Right 935128607 2:100244805-100244827 AGTTATAGTCAGAGGGTGGCTGG No data
935128600_935128607 -2 Left 935128600 2:100244784-100244806 CCCACTCAGGGTTTCTCCCGCAG No data
Right 935128607 2:100244805-100244827 AGTTATAGTCAGAGGGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935128607 Original CRISPR AGTTATAGTCAGAGGGTGGC TGG Intergenic
No off target data available for this crispr