ID: 935128981

View in Genome Browser
Species Human (GRCh38)
Location 2:100247338-100247360
Sequence ATGTGGCCCTGGAATGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935128976_935128981 -10 Left 935128976 2:100247325-100247347 CCTCCGGCCCTAAATGTGGCCCT No data
Right 935128981 2:100247338-100247360 ATGTGGCCCTGGAATGATGAAGG No data
935128967_935128981 27 Left 935128967 2:100247288-100247310 CCTCCAGAAGCATTGTAGGCTTT No data
Right 935128981 2:100247338-100247360 ATGTGGCCCTGGAATGATGAAGG No data
935128969_935128981 24 Left 935128969 2:100247291-100247313 CCAGAAGCATTGTAGGCTTTGGG No data
Right 935128981 2:100247338-100247360 ATGTGGCCCTGGAATGATGAAGG No data
935128974_935128981 -1 Left 935128974 2:100247316-100247338 CCTGCTGGTCCTCCGGCCCTAAA No data
Right 935128981 2:100247338-100247360 ATGTGGCCCTGGAATGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935128981 Original CRISPR ATGTGGCCCTGGAATGATGA AGG Intergenic
No off target data available for this crispr