ID: 935129404

View in Genome Browser
Species Human (GRCh38)
Location 2:100250071-100250093
Sequence CCCCATCTGCAAAATGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1013
Summary {0: 1, 1: 5, 2: 38, 3: 190, 4: 779}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935129399_935129404 -7 Left 935129399 2:100250055-100250077 CCTTGGGCCTCAGTTTCCCCATC 0: 35
1: 198
2: 708
3: 1741
4: 3190
Right 935129404 2:100250071-100250093 CCCCATCTGCAAAATGAGGAGGG 0: 1
1: 5
2: 38
3: 190
4: 779
935129396_935129404 28 Left 935129396 2:100250020-100250042 CCTGAGAGACAGGTTAACATGCA 0: 1
1: 0
2: 0
3: 17
4: 168
Right 935129404 2:100250071-100250093 CCCCATCTGCAAAATGAGGAGGG 0: 1
1: 5
2: 38
3: 190
4: 779

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935129404 Original CRISPR CCCCATCTGCAAAATGAGGA GGG Intergenic
900457157 1:2782759-2782781 CCTCCTCTGTAAAAGGAGGAGGG - Intronic
900508275 1:3041613-3041635 CTCCATCTGCAAAAAGTGGTAGG + Intergenic
901272599 1:7964284-7964306 CTTCAACTGTAAAATGAGGATGG - Intronic
901588886 1:10322362-10322384 CCCCATCTACATAATGGGGTTGG + Intronic
902242930 1:15100787-15100809 TCCCATCTGCAGAGCGAGGACGG + Intronic
902244032 1:15107545-15107567 CCTCATTTGTAAAATGAGTATGG + Intronic
902407454 1:16192454-16192476 CCCCATCTGCAAAATGGGGACGG - Intergenic
902623468 1:17663748-17663770 CCCCATCTGTAAAATGGGGTGGG - Intronic
902708355 1:18221965-18221987 CCTCATCTGTAAAATGAGAAGGG - Intronic
902721267 1:18305839-18305861 TCCTTTCTGTAAAATGAGGACGG - Intronic
902744707 1:18465911-18465933 CCCCATCTGTAAAATGGGTGGGG - Intergenic
903177501 1:21589817-21589839 CCCCATCTGTACAATGGGCAGGG - Intergenic
903189016 1:21646054-21646076 CCTCATCTGTAAAATGGGGATGG + Intronic
903288367 1:22291254-22291276 CTCCATCTGGGAAATAAGGATGG + Intergenic
903404777 1:23087196-23087218 CCCAATCTGCAAAGTGTGAAGGG - Exonic
903497990 1:23784014-23784036 CCTCATCTGTAAAATGGGAATGG - Intronic
903624240 1:24719912-24719934 CCTCATCTGTAAAATAACGATGG - Intergenic
903659669 1:24969458-24969480 CCTCCTCTGAAAAGTGAGGAGGG - Intergenic
903740355 1:25555089-25555111 CCTCATCTGTAAAATGGGGGTGG + Intronic
903800147 1:25961104-25961126 CCCCATCTTAAAAATAAAGAAGG - Exonic
903812413 1:26042091-26042113 CCCCATCTGTCAAATGGGGACGG - Intronic
903817792 1:26077664-26077686 TCTCATCTGTAAAATGGGGATGG - Intergenic
903853994 1:26325112-26325134 CCCCATCTGTAAAATGTGAGGGG + Intronic
903885100 1:26536510-26536532 CCCCATCTGTAACATGGGGTGGG - Intronic
903898083 1:26621627-26621649 CCCCATCTCTAAAATGGGGAAGG - Intergenic
903972770 1:27129878-27129900 CCTCAGCTGTAGAATGAGGAGGG - Intronic
904047524 1:27617390-27617412 CCCCATGTGTAAAATGGGGCTGG + Intronic
904203666 1:28838450-28838472 CCCCATCTGTAAAGTGAGAGAGG + Intronic
904273188 1:29363678-29363700 CTGCATCTGTAAAATGGGGATGG - Intergenic
904318934 1:29684035-29684057 CCCCATCTATAAAATGGGGATGG + Intergenic
904882927 1:33714390-33714412 CCTTATCTGCAAAATAGGGATGG - Intronic
904944346 1:34188482-34188504 CTTCATCTGCAAAGTGGGGATGG - Intronic
904947229 1:34208304-34208326 CACCAGCTGGAAAAGGAGGAGGG - Intronic
905270914 1:36786896-36786918 CCTCATCTGGAAAATGGGGTTGG - Intergenic
905531035 1:38678842-38678864 CCTCATCTGCACTATGGGGATGG + Intergenic
905827701 1:41038741-41038763 CCTCATCTGCAGAAGGAGGTGGG - Intronic
905922640 1:41729603-41729625 CTCCTTCTGTAAAATGAGTAGGG - Intronic
906002075 1:42435139-42435161 CTCCATCAGCAACATGGGGAAGG + Intronic
906559790 1:46748082-46748104 CCCCATCTGGAAAATAGAGATGG - Intergenic
906624028 1:47310077-47310099 CTTCATCTGTAAAATGAGGATGG - Intronic
906688701 1:47778782-47778804 CCTCATCTGCAAAGTGAGAATGG + Intronic
907043389 1:51283444-51283466 TGCCATCTGCAAAATGACAATGG + Intergenic
907159387 1:52359659-52359681 CCCTATCTATAAAATGAGGGTGG + Intronic
907289797 1:53406484-53406506 CCCCATGTGTAAAATGGAGATGG - Intergenic
907305110 1:53508987-53509009 CCCCCTCTGTAAAGTGGGGATGG + Intronic
907315877 1:53572268-53572290 CTCCATCTGTAAAATGAGAATGG + Intronic
907331464 1:53674490-53674512 CCACATGTGTAAAATGGGGACGG + Intronic
907491255 1:54810334-54810356 CCCCATCTGTTAATTGTGGATGG + Intronic
907738554 1:57140327-57140349 CCTCATCTGTAGAATGAGGGAGG - Intronic
908423570 1:63983209-63983231 CCATATCTGTAAAATGCGGAGGG - Intronic
908645600 1:66274647-66274669 CCTCGTCTCCAAAATTAGGATGG + Intronic
908857875 1:68449936-68449958 CACCAACTGCAGAATGAAGAAGG + Exonic
908983030 1:69981902-69981924 CCTCATCTATAAAATGGGGATGG - Intronic
909623134 1:77687627-77687649 CCCCGTCTGCGAAGTGAGGAGGG + Intergenic
909661011 1:78082133-78082155 CCACATCTGTAAAATAAGGTTGG - Intronic
910123911 1:83819610-83819632 CCACAGCTGCAAACTGAGGGAGG - Intergenic
910226753 1:84943739-84943761 TCCCACCTACAAAATGGGGAGGG + Intronic
910725862 1:90338100-90338122 CTTCATCTACAAAATGATGATGG + Intergenic
910743504 1:90547880-90547902 CCTCATCTGTAAAATGGGGCTGG + Intergenic
911498266 1:98656783-98656805 CCTCATCTGTAAAATGGGGATGG + Intergenic
912966807 1:114242971-114242993 CCCCATCTGGGAACTGAGGAGGG + Intergenic
913355565 1:117917560-117917582 CCTCATCTCTAAAATGGGGATGG - Intronic
913611212 1:120511514-120511536 ACACAACTGGAAAATGAGGATGG + Intergenic
914579979 1:149010725-149010747 ACACAACTGGAAAATGAGGATGG - Intronic
914887493 1:151597372-151597394 CCTCATCTGCAAACTTCGGAGGG + Intergenic
915718001 1:157962643-157962665 CCGCATCTGTCAAATGAGGTGGG + Intergenic
915828798 1:159105909-159105931 CCCCATCTTCAAACCAAGGATGG - Intronic
915892163 1:159782374-159782396 CCCCATCGACAACATGGGGAAGG - Exonic
916673844 1:167049672-167049694 CCTCATCTGTAAAATGGAGAGGG + Intergenic
916744405 1:167673563-167673585 CAACATCTGTAAAATGAGGTGGG - Intronic
917514707 1:175697860-175697882 TTATATCTGCAAAATGAGGATGG - Intronic
917839579 1:178966744-178966766 CCTCATCTGTGAAATGAGGATGG + Intergenic
918655140 1:187016097-187016119 CCTCATCTCTAAAATGAGAATGG + Intergenic
919753934 1:201054825-201054847 CTGCATCTCCAAAATGAGAAGGG - Intronic
919971832 1:202585481-202585503 CCCTGTCTGTAAAATGAGGTTGG + Exonic
920040138 1:203090187-203090209 GCCCACCTGCAAAATCAGCAGGG - Intergenic
920092893 1:203466683-203466705 CCTCATCTGTAAAGTGGGGATGG + Intergenic
920095584 1:203484348-203484370 CCTCATCTGTAAAGTGAGAATGG + Intronic
920177403 1:204111270-204111292 CCTCATCTGTAAAATGAGCATGG - Intronic
920436032 1:205947791-205947813 CCTCATATGTAAAATGAGGGAGG - Intergenic
920689072 1:208131967-208131989 CCCCGTTTGACAAATGAGGAAGG - Intronic
921307407 1:213810817-213810839 TCTTATCTGTAAAATGAGGATGG - Intergenic
923262419 1:232279830-232279852 CTTCCTCTGTAAAATGAGGATGG + Intergenic
923339420 1:232994998-232995020 CTTTATCTGCAAGATGAGGAGGG + Intronic
923614037 1:235521752-235521774 CCTCATCTGTAAAATAAGGAAGG - Intergenic
923755263 1:236785839-236785861 CCCCACCTTCAAACTGGGGAGGG + Intergenic
923966761 1:239150114-239150136 CCTTATCTGCAAAAAGTGGATGG - Intergenic
924014848 1:239709994-239710016 CCACCTATGCCAAATGAGGAAGG + Intronic
924157887 1:241199941-241199963 CTTCATCTGCAAAATGTGGGTGG + Intronic
924219883 1:241863221-241863243 CCTCATCTGTAAAATGAGAATGG - Intronic
924673554 1:246152809-246152831 CCACATCTGCAAAATGGGGATGG + Intronic
1062843959 10:690334-690356 CCCCATCTGTGAAAAGGGGATGG + Intergenic
1062995127 10:1858465-1858487 TCTCACCTGCAAAATGAGTAGGG - Intergenic
1064098957 10:12446707-12446729 CTCCAACTGCAAAAAGAGAAAGG - Intronic
1064291675 10:14040082-14040104 CTCCATCTGTAAAACAAGGATGG - Intronic
1064681516 10:17815178-17815200 CCCCATCTGTAAAATAAAGGGGG - Intronic
1064893349 10:20205789-20205811 CCTCATCTGTAAGATGAGGTGGG - Intronic
1065182397 10:23139798-23139820 CCCCATCTCCAAACTAGGGATGG - Intergenic
1065319474 10:24495731-24495753 GCCCAGCTGCAATATGGGGATGG + Intronic
1065825184 10:29564226-29564248 CCGGATCTGTAAACTGAGGATGG - Intronic
1065865214 10:29909124-29909146 CCTCCTGTGCAAAATGAGCAAGG + Intergenic
1065952222 10:30662684-30662706 CCAGATCTGTAAACTGAGGATGG + Intergenic
1066025973 10:31361538-31361560 CACCATCTGGGAAGTGAGGAGGG - Intronic
1067185708 10:44025344-44025366 GCCCCTCTGTAGAATGAGGATGG + Intergenic
1067209993 10:44252108-44252130 CCAGATCTGAAGAATGAGGATGG + Intergenic
1068594471 10:58888018-58888040 CCCCTTCTGCCATGTGAGGAAGG - Intergenic
1068831838 10:61505069-61505091 CCACACCTGGAAAATGATGAAGG - Intergenic
1068870379 10:61937065-61937087 CCTCATCAGTAAAATGAGAAAGG + Intronic
1069629612 10:69889636-69889658 CTCCATCTGAAGCATGAGGATGG + Intronic
1069865807 10:71502065-71502087 CCCTCTCTGCAAAATGAGAAGGG + Intronic
1070394764 10:76002497-76002519 CTACATCTGTAAAATGGGGATGG + Intronic
1070626466 10:78054514-78054536 CCTCATCTGCAAAAGCGGGAAGG - Exonic
1070770962 10:79082141-79082163 GCCGCTTTGCAAAATGAGGAAGG - Intronic
1071277153 10:84065729-84065751 CTCCATCTGCAAAATGGTGGTGG - Intergenic
1071304935 10:84291102-84291124 CTTCATCTGTAAAATGAGGATGG + Intergenic
1071305072 10:84292499-84292521 CTTCATCTATAAAATGAGGATGG - Intergenic
1071400282 10:85261955-85261977 CCTCATTTGCAAAATAAGGTAGG + Intergenic
1071792201 10:88966699-88966721 CCTCATCTGCAAAATGACAATGG + Intronic
1071908424 10:90201690-90201712 CCCAATCTGTTAAATGAGGCCGG + Intergenic
1072620059 10:97073798-97073820 TCTCATCTGCAACATGGGGATGG + Intronic
1072626033 10:97112575-97112597 CCTCATCTGTGAAATGGGGATGG - Intronic
1072733378 10:97863224-97863246 CCTCACCTGTAAAATGGGGATGG + Intronic
1072927597 10:99630000-99630022 CCCCATCTCAAAAAAGAAGAGGG + Intergenic
1073178076 10:101568731-101568753 CTTCATCTGCAAAATGGGGATGG + Intergenic
1073541904 10:104321751-104321773 ACCCATCTGCAAAACAGGGATGG - Intronic
1073584658 10:104698204-104698226 CCACATCTGTAAAATGGGGCTGG - Intronic
1074059086 10:109948693-109948715 CCTCCTCTGTGAAATGAGGATGG - Intronic
1074102666 10:110365728-110365750 CCTCATCTGTAAAATGGGAATGG + Intergenic
1074198307 10:111208432-111208454 CCTCATCATCAAAATGTGGAGGG - Intergenic
1074221768 10:111444959-111444981 CCCCATCTTCGTAATGAGGAGGG - Intergenic
1074446402 10:113524688-113524710 ACCCATCTGTACAATGGGGATGG - Intergenic
1074596945 10:114876453-114876475 CCTTATCTGTAAAATGGGGATGG + Intronic
1074760543 10:116664420-116664442 TCTCTTCTGCGAAATGAGGAGGG - Intronic
1074881587 10:117663573-117663595 CCCCATCTGGAAAAGGTGAATGG + Intergenic
1074892209 10:117745025-117745047 CCTTATTGGCAAAATGAGGATGG + Intergenic
1074921323 10:118016820-118016842 CCTCATCTGTAAAATGGAGATGG + Intronic
1075025884 10:118982725-118982747 CCTCATCTGCAAAATGGGAGAGG - Intergenic
1075545779 10:123353378-123353400 TCCCATCTGTAAAATGAGGGTGG + Intergenic
1075585731 10:123656753-123656775 CTCCACCTGCGAAATGAGGTGGG - Intergenic
1075659051 10:124180761-124180783 CCCCATCTGTAAATTGGGGTGGG - Intergenic
1075739087 10:124682511-124682533 TCTCATCTGTAAAATGAGGTTGG - Intronic
1077490497 11:2858789-2858811 CTCCATCTGCTCACTGAGGAGGG - Intergenic
1077724481 11:4660844-4660866 CCCCATCAGCATCCTGAGGATGG + Intergenic
1077747448 11:4923180-4923202 CCTCAACTGCAGAATGAGCAAGG - Intronic
1078083842 11:8222026-8222048 CCCCATTTCCCAGATGAGGATGG + Intergenic
1078402983 11:11044499-11044521 CCTCAACTGTAAAATGAGGATGG + Intergenic
1078527608 11:12112058-12112080 CCCCATCTCTAAAATGGGGAGGG - Intronic
1078850196 11:15156681-15156703 CTCCATCTGTAGAATGGGGATGG + Intronic
1079032357 11:16995123-16995145 CCTCATCTGAAAAATGGGGATGG - Intronic
1079122881 11:17697644-17697666 CCTCATCAGAAAGATGAGGATGG - Intergenic
1079336134 11:19572306-19572328 CCCCGTCTGCCAAATAAGAAGGG - Intronic
1079637452 11:22761750-22761772 CCCCATCTGTAAAATGGAAATGG - Intronic
1080846153 11:36028895-36028917 CCTCATCTGCAAAATGGAAATGG + Intronic
1080849006 11:36051442-36051464 CCACATCTGTAAAATGAGATAGG + Intronic
1081354583 11:42096501-42096523 CCTCCTCTGTAAAATGAGGTGGG + Intergenic
1081647186 11:44798347-44798369 CCCTGTCTGTGAAATGAGGATGG - Intronic
1081679022 11:44988918-44988940 CCTCACCTGCAAAATGGAGATGG + Intergenic
1081800381 11:45854833-45854855 CCTCATCTATAAAATAAGGATGG + Intronic
1081941185 11:46943713-46943735 CCACATCTCCAAAATGTGGGTGG + Intronic
1082013207 11:47464889-47464911 GCTCATCTGTAAAACGAGGATGG + Intergenic
1082974860 11:59061396-59061418 CTCCAACTGAAAAATAAGGAGGG - Intergenic
1082979283 11:59105126-59105148 CTCCAACTGAAAAATAAGGAGGG - Intergenic
1083237937 11:61363847-61363869 TCTCATCTGTAAAATGGGGAAGG + Intronic
1083300714 11:61738391-61738413 CCCCATCTGCACAATGACAGGGG - Intronic
1083319172 11:61834852-61834874 CCGCCTATGCAAAATGAGCAAGG - Intronic
1083402109 11:62430690-62430712 CCCCATCTTCAAAGTCAGCAGGG + Intergenic
1083641725 11:64149309-64149331 CCTCCTCTGCAAAATGAGGGTGG - Intronic
1083700507 11:64474447-64474469 CCTTTTCTACAAAATGAGGATGG + Intergenic
1083739096 11:64698478-64698500 CCTCTTCTGCAAAATGAGAGGGG + Intronic
1083889262 11:65587843-65587865 CCTCATCTGTAAAGTGGGGAGGG + Intronic
1083924993 11:65800694-65800716 CCTCATCTATAAAATGAGGTGGG + Intergenic
1084539470 11:69776877-69776899 CCCCATTTGCAAAATGACATGGG + Intergenic
1084551278 11:69843633-69843655 CCCCATTTTAAAAATGAGGAGGG + Intergenic
1085243073 11:75074675-75074697 CCCACTCTGCAAAATGCAGAGGG - Intergenic
1085456284 11:76667212-76667234 TCCCTTCTGTAAAATGATGATGG - Intronic
1085473598 11:76773904-76773926 TCCCACCTGTAAAATGAGAAAGG + Intergenic
1085477466 11:76797213-76797235 CCCCATCTGTCACATGAGAAGGG - Exonic
1085620335 11:78033036-78033058 CCTCATCTGCAAAATGAGGAGGG + Intronic
1085640160 11:78188441-78188463 TCCCATCTGTGAAATGGGGATGG - Intronic
1086165721 11:83775449-83775471 CCTCATCTGTAAAATGAGTAAGG + Intronic
1086333068 11:85773146-85773168 CCACATCTGCAAAAACAAGAGGG + Intronic
1086400136 11:86454601-86454623 CCCAATCTGTAAAATGAGGATGG - Intronic
1086622743 11:88907141-88907163 CCTCATCTATATAATGAGGATGG + Intronic
1087567986 11:99887571-99887593 GGCCATCTGCAAACTGAGCAAGG + Intronic
1089015038 11:115158633-115158655 CATCATCTGTAAAATGAGGCTGG - Intergenic
1089350454 11:117818998-117819020 CCCCTTCTGTAAATTGAAGACGG + Intronic
1089637437 11:119824410-119824432 CCTCATCTGTAAAATGAGAATGG - Intergenic
1089683580 11:120133012-120133034 CCCCATCTGCAAGGTGAAGGAGG - Intronic
1089683923 11:120134848-120134870 CCCTATCTGCAAGGTGAGGGAGG + Intronic
1090358320 11:126155565-126155587 TTCCATCTGTAAAATGGGGATGG - Intergenic
1091157710 11:133388955-133388977 CCTCATCTGCAACATGGGGATGG - Intronic
1091320167 11:134643721-134643743 CCTCCTCTGTAAAATGAGAATGG + Intergenic
1091327822 11:134704341-134704363 CCCCACCTGCACACTAAGGAAGG + Intergenic
1091341910 11:134822701-134822723 CCTCATCTATAAAGTGAGGATGG - Intergenic
1091446534 12:546876-546898 CCCCATCTGTGAAACGAGGACGG - Intronic
1091627793 12:2136341-2136363 CCCCATTTTAAAGATGAGGAAGG + Intronic
1091901477 12:4147507-4147529 CCTCATTTGCAAAACAAGGATGG + Intergenic
1091997188 12:5002861-5002883 CCTGCTCCGCAAAATGAGGAAGG - Intergenic
1092039776 12:5374026-5374048 CCTCATCTGTAAGATGGGGATGG - Intergenic
1092078673 12:5694585-5694607 CCCCATGTATAAAATGAAGAGGG + Intronic
1092218445 12:6697925-6697947 TCCCATCTTCCAAAGGAGGATGG + Intronic
1092364962 12:7870252-7870274 CCCCATCTGCAAAATGAGCAAGG + Intronic
1092383160 12:8014861-8014883 CCCGATCTGCGAAATGAGCAGGG + Intergenic
1092980016 12:13785271-13785293 CCCCATCTGCATAATATGTAAGG + Intronic
1094069816 12:26400874-26400896 CCTCATCTGTAAAATGGGGAGGG + Intronic
1094179829 12:27580425-27580447 CCACATCTGTAAAATGGGGATGG + Intronic
1094423305 12:30295046-30295068 CTCCTTCTGAAAAATAAGGAAGG + Intergenic
1094567902 12:31616617-31616639 CCTCACCTGCAAAATGAGAATGG + Intergenic
1095395131 12:41754190-41754212 CCCCTTCTGCCAAATGAGGATGG + Intergenic
1095481358 12:42639278-42639300 CCCTATTTGTAAAATGAGGAGGG - Intergenic
1096290262 12:50336282-50336304 CCTCTTCTGTAGAATGAGGATGG - Intronic
1096670375 12:53195013-53195035 CCTCATCTGTAAAATAGGGATGG + Exonic
1097500241 12:60392466-60392488 CCCCACCTACAAGATGGGGAAGG + Intergenic
1097614543 12:61868232-61868254 CCTCATCTACAAAATGGGGATGG - Intronic
1098068928 12:66650928-66650950 CTTCATCTCCAAAATGAGCATGG + Intronic
1098457008 12:70685851-70685873 TCCTATCTGAAAAATGGGGAAGG - Intronic
1098615921 12:72522092-72522114 CCTCATCTGTAAAATGGAGATGG - Intronic
1098815833 12:75160624-75160646 TCCCATCTGTAAAAAGATGAAGG + Intronic
1098842969 12:75499229-75499251 CTAAATCTGCAAAATGAGCAAGG + Exonic
1099385641 12:82009475-82009497 CTCATTCTGCACAATGAGGACGG + Intergenic
1100585257 12:95973417-95973439 CCTTATCTGTGAAATGAGGAAGG + Exonic
1100957121 12:99921175-99921197 CCCCATCTGTCAACAGAGGAAGG + Intronic
1101347783 12:103902402-103902424 TCTCATCTGTAAAATGAGAATGG - Intergenic
1101422754 12:104562958-104562980 CCCCATCTGTGAAATGGGTATGG + Intronic
1101659724 12:106754887-106754909 CTCCATCTGTAAAATGGGGTGGG + Intronic
1101841579 12:108331249-108331271 TCCCATCTGTGAAATGGGGATGG - Intronic
1101842354 12:108337355-108337377 CACCATCTGTAAAATGGGGTGGG - Intronic
1102016652 12:109652435-109652457 CCTCATCTGTAAAATGGGGCGGG + Intergenic
1102131978 12:110538750-110538772 CCTCATCTGCAAAACGGGGATGG + Intronic
1102171412 12:110845464-110845486 CCCCATCTGTAAAATGAGGATGG + Intergenic
1102186346 12:110951042-110951064 CCCCGTCTGGGAAGTGAGGAGGG - Intergenic
1102469247 12:113150294-113150316 CAGCATCTGTAAAATGGGGAGGG + Intronic
1102514717 12:113438659-113438681 CTGCATCTGTAAAATGGGGATGG - Intergenic
1102560225 12:113756789-113756811 TCCCATCTGTAAAATGGGGCTGG - Intergenic
1102801690 12:115740670-115740692 CTCCATCTGTAAAATGGGGGTGG + Intergenic
1102946648 12:116995294-116995316 TCTCTTCTGTAAAATGAGGAGGG + Intronic
1102958079 12:117072422-117072444 CCTCATCTGGAAAGTGAGCATGG - Intronic
1103475694 12:121216961-121216983 CCACTTCTGCCAAATGGGGATGG - Exonic
1103598643 12:122040116-122040138 CTCCATCTGTAAAATGCGGTTGG - Intronic
1103822952 12:123712787-123712809 CCCCGTCTGGACAATGGGGACGG - Intronic
1103956078 12:124577615-124577637 CCTCATCTGTAAAATGGGGCTGG + Intergenic
1104152118 12:126093905-126093927 TCTCATCTGCTAAATGGGGATGG - Intergenic
1104157515 12:126148165-126148187 CTCCATCTGGAAAATGAGGATGG - Intergenic
1104379586 12:128295434-128295456 TCTCATCTGTAAAATGGGGATGG - Intronic
1104481115 12:129109344-129109366 TCTCCTCTGCAAAATGGGGATGG + Intronic
1105211966 13:18262165-18262187 CCCCATCTGTAAAACGAGTCAGG - Intergenic
1105636757 13:22223085-22223107 CCTCATCTGTAAAATGAAGATGG - Intergenic
1106203084 13:27560218-27560240 CCCCACCTCCAAAATGACCAAGG + Intronic
1106727822 13:32504371-32504393 GGCCATCTACAAACTGAGGAGGG - Intronic
1107303531 13:38993144-38993166 TCTCATCTGTAAAATGGGGATGG + Intergenic
1107631654 13:42349212-42349234 CCTCATCAGCAAAATGGGGATGG - Intergenic
1107863312 13:44681663-44681685 CCACATCTGCAAAATGACCCTGG - Intergenic
1107998820 13:45888157-45888179 CCTCATCTGCAAAAGAGGGATGG - Intergenic
1108687399 13:52832597-52832619 CCACATCAGCAAAATGGGAATGG + Intergenic
1110146513 13:72198028-72198050 CCCTACCTGCAAGATGAGAATGG - Intergenic
1112166864 13:96928979-96929001 GGCCATCTGCAAGCTGAGGAAGG + Intergenic
1112373758 13:98819548-98819570 CCACATTTGCAAAATGAAGTAGG + Intronic
1113734090 13:112664769-112664791 CTCCATCTGCCACAGGAGGAAGG - Intronic
1114262668 14:21049606-21049628 GCTCATTTGCAACATGAGGAAGG - Intronic
1114411354 14:22503532-22503554 TCTCATCTGTAAAATGGGGATGG + Intergenic
1114770461 14:25425102-25425124 CCCCATCTGTAACATGAGTCGGG - Intergenic
1116568467 14:46483472-46483494 CCCTATCTGCAAAAATATGATGG - Intergenic
1116815367 14:49578988-49579010 CCTCATTTGTAAAATGGGGACGG + Intronic
1116853935 14:49935508-49935530 CTCCATCTGTAAAATGAAGATGG + Intergenic
1117838326 14:59830736-59830758 TCTGATCTGCAAAATGAGGATGG + Intronic
1118316113 14:64727136-64727158 CCTCACCTGTAAAATGAGGATGG - Intronic
1118584188 14:67336695-67336717 CCTCATCTGCAAAGTGGAGATGG + Intronic
1118595180 14:67429903-67429925 CTTCATTTGTAAAATGAGGAAGG - Intergenic
1118657811 14:67971832-67971854 CTCCATCTGTAAAATGATAATGG + Intronic
1118666912 14:68080176-68080198 TCCCATTTGCAAAATAAGGATGG + Intronic
1118769377 14:68931649-68931671 CCACATCTGTAAAATGGGGATGG + Intronic
1118771152 14:68943565-68943587 CCCCATCTTGAAACTGAGGATGG - Intronic
1119036166 14:71231764-71231786 CCCCACCTTCAAACTGGGGAGGG + Intergenic
1119060536 14:71469693-71469715 TCTCATGTGAAAAATGAGGAAGG + Intronic
1119643736 14:76333978-76334000 CCCCATCTGTAAAATGGGGCAGG + Intronic
1119684524 14:76620792-76620814 CCCCATCTTTGAAATGGGGAGGG + Intergenic
1119812935 14:77538978-77539000 CTTCATCTGCAAAATGGGAATGG + Intronic
1120011406 14:79419740-79419762 CCTCATTGACAAAATGAGGATGG + Intronic
1120885012 14:89445243-89445265 CCCCATCTGTAAAATGGGGATGG + Intronic
1120951411 14:90045340-90045362 CCCCAACTACAAAATGAAGGTGG + Intergenic
1120983301 14:90310382-90310404 CCTCATTTGTAAAATGAAGAGGG + Intronic
1121248468 14:92482164-92482186 CCTCATCTGTTAAATGAGAAAGG - Intronic
1121265146 14:92597046-92597068 CCTCATCTAGAAAATGCGGATGG + Intronic
1121319856 14:92985894-92985916 TCCTATCTGTAAAATGGGGAGGG - Intronic
1121495632 14:94389898-94389920 CCCTATCTGTAAAATGGGGATGG + Intronic
1121507795 14:94489885-94489907 CTCCATCCACAGAATGAGGAGGG + Intronic
1121702257 14:95963489-95963511 ACTCATCCGCAAAATGGGGATGG - Intergenic
1121828228 14:97028039-97028061 CCCCATCTGAAAATGGAGGCAGG + Intergenic
1121931185 14:97973851-97973873 CCCCATCTGCACCCTCAGGAAGG + Intronic
1122074870 14:99229530-99229552 CTCCATCTGCAAAATGGGGATGG + Intronic
1122118242 14:99538160-99538182 CTGCACCTGGAAAATGAGGATGG - Intronic
1122151930 14:99730330-99730352 CCCCATCTGTGAAATGGGGGTGG - Intergenic
1122236489 14:100333353-100333375 CCCTACTTGCAAAATAAGGATGG + Intergenic
1122623464 14:103072642-103072664 CCTTATCTGCACAGTGAGGAGGG - Intergenic
1123416268 15:20097771-20097793 TCCCATCTGAACCATGAGGAAGG - Intergenic
1123525607 15:21104876-21104898 TCCCATCTGAACCATGAGGAAGG - Intergenic
1123762713 15:23445099-23445121 TCACATCTGTAAAATGGGGATGG - Intronic
1124334494 15:28846852-28846874 TCACATCTGTAAAATGGGGATGG - Intergenic
1124486070 15:30117759-30117781 CCTCATCTGTAAAATTGGGATGG + Intergenic
1124641205 15:31397633-31397655 CCCCATCTATAAAATGAAGATGG + Intronic
1124757514 15:32420842-32420864 CCTCATCTGTAAAATTGGGATGG - Intergenic
1125732385 15:41900509-41900531 CCCCATCTGTAGAATGGGGAGGG - Exonic
1126718059 15:51543383-51543405 TTCCATATGCAAAATGAGAAGGG - Intronic
1126928176 15:53614764-53614786 CCTCATTTACAAAATGAGGTGGG - Intronic
1127295197 15:57602776-57602798 CCTCATCTGAAAAATGGGGCAGG + Intronic
1127310097 15:57744853-57744875 CCACATCTGCAGAATGGGGCTGG - Intronic
1127965844 15:63922448-63922470 CCCCTTCTGCAGAGGGAGGATGG - Intronic
1128346007 15:66852779-66852801 CCCCTTCTGTGAAATGGGGACGG - Intergenic
1128547340 15:68577358-68577380 ACTCATCAGCAAAATGGGGACGG + Intergenic
1128700452 15:69800222-69800244 CCCCTTCTGCAAAATAGGGGTGG - Intergenic
1128704213 15:69826969-69826991 CCTTCTCTGCAAAATTAGGAAGG - Intergenic
1128725703 15:69987023-69987045 CCCCATCTGTGAAATGAGGAGGG - Intergenic
1128752716 15:70160727-70160749 TCCCCTCTGTAAAATGAGGGTGG + Intergenic
1128793005 15:70446893-70446915 CCTCATCTGTAAAACAAGGATGG + Intergenic
1128812777 15:70584789-70584811 CCCCATCTGTTAAGTGAAGAGGG - Intergenic
1128866710 15:71119881-71119903 CCCCATGTGTAACAAGAGGATGG + Intronic
1128904695 15:71456522-71456544 TCCCATCTGTGAAATGGGGATGG - Intronic
1129052765 15:72796742-72796764 CCCCATCTGCAGAATGGGGATGG + Intergenic
1129328692 15:74815874-74815896 CCCCATCTAACAGATGAGGAAGG - Intronic
1129329031 15:74817328-74817350 TCCCATCTCTAAAACGAGGATGG - Intronic
1129356170 15:74993594-74993616 CCACATATGTAAAATAAGGATGG - Intronic
1130114950 15:80998752-80998774 CCCTATCTGAAAAATGAAGCAGG + Intergenic
1130743409 15:86625228-86625250 CCCAATCTGTAAAATGAAGGTGG + Intronic
1130926177 15:88387592-88387614 CCTTATCTGTAAAATGGGGATGG + Intergenic
1130960554 15:88656026-88656048 TCCTATTTGTAAAATGAGGAAGG + Exonic
1131045290 15:89310029-89310051 CCCCATATGCATGATGAGAAAGG + Intronic
1131386965 15:92015796-92015818 CCCCATTTGCTCAATCAGGAAGG + Intronic
1131515918 15:93076710-93076732 CTTCATCTGCAAAATGAGGATGG - Intronic
1131737574 15:95350144-95350166 CCTCATCTGGAAAATGAGGAGGG + Intergenic
1132175662 15:99711931-99711953 CCTCATCTGGAAAATGGGGATGG + Intronic
1132343348 15:101091772-101091794 TCCCATGTGCACAATGGGGATGG - Intergenic
1132392397 15:101448640-101448662 CCCCATCAGTCAGATGAGGATGG - Intronic
1133296171 16:4753540-4753562 CCCCATCTGCAGGATGGAGATGG - Intronic
1133331787 16:4979402-4979424 CTCCATCTGTCAAATGCGGAGGG + Intronic
1133411093 16:5569571-5569593 CCTCATCTGTGAAATGGGGATGG - Intergenic
1133463981 16:6012202-6012224 CCTCATCTGTAGAATGAGGATGG + Intergenic
1133777186 16:8905980-8906002 CCTCATCTGCCAAATGAGTATGG + Intronic
1133872795 16:9705227-9705249 CCTCATCTGTAAAAGGCGGATGG - Intergenic
1134095600 16:11416446-11416468 CCTCATCTGCAGAATGGGAATGG + Intronic
1134260200 16:12644990-12645012 CTTCATCTGTAAAATGGGGAAGG - Intergenic
1134448570 16:14349008-14349030 CCTCACCTGCAAAATGGGGCAGG - Intergenic
1134557961 16:15182476-15182498 TCCCATTTGTAAAATCAGGAAGG - Intergenic
1134632546 16:15767292-15767314 CCCTATCTGCAAAACGGAGATGG + Intronic
1134693450 16:16206027-16206049 TTCCATCTGCAAAATGGGGTCGG + Intronic
1134918497 16:18094079-18094101 TCCCATTTGTAAAATCAGGAAGG - Intergenic
1135169100 16:20167219-20167241 CCCCATCTGTAAAATGGGGTAGG + Intergenic
1135762880 16:25151664-25151686 CCCCATCTTCAAAAAGGGGGTGG - Intronic
1136061771 16:27731504-27731526 CCCCATCTGTAAAATGGAGCTGG - Intronic
1136065425 16:27755195-27755217 CCTCATCTCCAAAATGAAGCTGG + Intronic
1136067209 16:27767267-27767289 CCTCATCTATAAAATGAGGAGGG + Intronic
1136224133 16:28847138-28847160 CCTCATCTGCAAAATTAGATGGG - Intronic
1136369355 16:29826251-29826273 CCTCATCTACAAAATGAGAATGG - Intronic
1136372317 16:29844140-29844162 CCTCATCTGTAAAATGGGGGTGG + Intronic
1136500524 16:30667779-30667801 CCTCATCTGTAAAATGAGTAGGG + Intronic
1136517085 16:30774741-30774763 CAGCACCTGCAAGATGAGGAAGG - Exonic
1136556103 16:31008698-31008720 CCTGCTCTGCAAACTGAGGAGGG + Intronic
1136688161 16:32008289-32008311 CCCCATCTGTAAAATGGGGATGG - Intergenic
1136788765 16:32951844-32951866 CCCCATCTGTAAAATGGGGATGG - Intergenic
1136881048 16:33902090-33902112 CCCCATCTGTAAAATGGGGATGG + Intergenic
1137469026 16:48738012-48738034 CCCCATCTTACAGATGAGGACGG - Intergenic
1137598691 16:49741866-49741888 CCTCACCTAGAAAATGAGGATGG + Intronic
1137605935 16:49786775-49786797 CCTCATCTGTCAAATGAGGATGG + Intronic
1137699314 16:50484912-50484934 CCCTGTCTGTAAAATGGGGAGGG - Intergenic
1137768795 16:50998020-50998042 CCCCAACTGCAAAATGGGGGCGG - Intergenic
1137883211 16:52074435-52074457 CCCCATCTTGCAGATGAGGAAGG + Intronic
1138139833 16:54558644-54558666 CCTCATCTGTAAAATGGGGATGG + Intergenic
1138139987 16:54559801-54559823 CCTCATCTGTAAAATGGGGATGG - Intergenic
1138305050 16:55966740-55966762 CCCCATCTATAAAGTGGGGAGGG - Intergenic
1138307263 16:55989176-55989198 CCCCATCTAGGAAGTGAGGAGGG + Intergenic
1138555264 16:57767152-57767174 CATCATCTGTAAAATGGGGATGG - Intronic
1138598220 16:58040772-58040794 CCTCATCTACAAAATGGGGATGG - Intronic
1138657815 16:58500971-58500993 CCCCACCTACAAAATAAGGCAGG - Intronic
1138835629 16:60431105-60431127 TCCTATCTGTAAAATGAGGAAGG - Intergenic
1139365245 16:66428618-66428640 CCCCATCTGGAACATGGGGAAGG + Intronic
1139824348 16:69745336-69745358 CCCCATCTGTAAAATGGAGACGG - Intronic
1140739801 16:77931007-77931029 CTAAATCTGTAAAATGAGGAGGG - Intronic
1140838805 16:78819978-78820000 CAACATCTGTAAAATGGGGATGG + Intronic
1140989953 16:80201144-80201166 CCTCAACTGCAAAATGGGAATGG - Intergenic
1141096655 16:81167821-81167843 CCTCATCTGCAAGATGGGGGGGG + Intergenic
1141143386 16:81512471-81512493 TCCCATCTGACAAATGAGGAAGG - Intronic
1141309290 16:82897543-82897565 CCTCATCTATAAAATGGGGATGG - Intronic
1141310761 16:82911542-82911564 CTCCATCTGTAAAATGGGGATGG + Intronic
1141475514 16:84270526-84270548 CCCCATCTGAAAAGTAGGGAAGG - Intergenic
1141513593 16:84528233-84528255 CCCCATCTGTAAGATGTGGGTGG + Intronic
1141844275 16:86596528-86596550 CCCCACCTGTAAAATTAGGTTGG - Intergenic
1141915077 16:87090259-87090281 CCTCCTCTTCAAAATGTGGATGG - Intronic
1141983763 16:87566208-87566230 CCTCCTCTGTAAAATGAGGGTGG + Intergenic
1203090962 16_KI270728v1_random:1213333-1213355 CCCCATCTGTAAAATGGGGATGG - Intergenic
1142895187 17:2971664-2971686 CCTCATCTGTGAAATGATGATGG + Intronic
1143258598 17:5582452-5582474 CCCCATCTGCCACATGGGGAGGG + Intronic
1143382647 17:6506179-6506201 AACCAGCTGCATAATGAGGAAGG + Intronic
1144006822 17:11107992-11108014 CCCCATTTGGGAAATCAGGACGG + Intergenic
1144378531 17:14669708-14669730 CCTCATCTGTAAAATGTAGATGG - Intergenic
1144409677 17:14988508-14988530 CCTCATCTGTAAAATGGAGATGG - Intergenic
1144754534 17:17671173-17671195 CCTCATCTGTAAAATGGGGCTGG + Intergenic
1144764913 17:17727413-17727435 CCCCATCTGTGAAATGGGCAGGG - Intronic
1144765869 17:17732134-17732156 CTTCATCTGTAAAATGGGGATGG - Intronic
1145000659 17:19302290-19302312 TCTCATCTGCAGAATGGGGACGG - Intronic
1145019574 17:19418930-19418952 TGCCATCTGCAACATGAGGGAGG - Intergenic
1145249315 17:21288681-21288703 CCTCATCTGCAGACTGAGAATGG + Intronic
1145255641 17:21320824-21320846 CCTCATCTGCAAATTGGGGCAGG + Intergenic
1145320973 17:21767124-21767146 CCTCATCTGCAAATTGGGGCAGG - Intergenic
1145853822 17:28132937-28132959 TTTCATCTGCAAAATGGGGATGG - Intronic
1145868745 17:28256802-28256824 CCTAATCTGTAAAATGGGGATGG - Intergenic
1145927672 17:28659739-28659761 CCCCGTCTGGGATATGAGGAGGG - Intronic
1146091893 17:29887557-29887579 CCTCATCTGTAAAATGAGGATGG + Intronic
1146176903 17:30670943-30670965 CCTCATTTATAAAATGAGGATGG + Intergenic
1146457833 17:33020959-33020981 CCCCATCTATGCAATGAGGACGG - Intronic
1146458469 17:33025298-33025320 CCCCAGCTGGAAAACTAGGAGGG - Intronic
1146973777 17:37093855-37093877 CCTCATCTGTAAAATGGGGGTGG - Intronic
1147149151 17:38503993-38504015 CCACATCTGTAAAATGGGGATGG - Intronic
1147442238 17:40454221-40454243 CCTCATCTCCAAAATGAGTGAGG - Intronic
1148340783 17:46872365-46872387 CCTAATCTGTAAAATGGGGACGG + Intronic
1148427901 17:47616123-47616145 CCCCATGTGTAAAATGAGATGGG - Intronic
1148733253 17:49850646-49850668 CCCCATCTGCATCAGGAGAATGG - Intergenic
1148867083 17:50634439-50634461 CCTCATCTGTAAAATGGGAAGGG - Intergenic
1148988610 17:51646217-51646239 TCCCATCTGTAAACTGGGGATGG + Intronic
1149016475 17:51914182-51914204 CCCCAGCTGCAAAAACAGTAAGG + Intronic
1149031484 17:52087807-52087829 CCCCATCTGATAAATAAGGGGGG - Intronic
1149051105 17:52306435-52306457 GACCATCTGCAAGCTGAGGAAGG - Intergenic
1149194907 17:54108029-54108051 CCCCATCTGTGAAATGAGATGGG - Intergenic
1150233319 17:63571626-63571648 CCTTTTCTGAAAAATGAGGATGG + Intronic
1150802551 17:68292908-68292930 CCAGATCTGTAAAATGGGGATGG + Intronic
1151461216 17:74255255-74255277 CCCCATCTATAGAATGAGTATGG + Intronic
1151701082 17:75742891-75742913 CTCCATCTGTAAAATGGGTAAGG + Intronic
1151806425 17:76408375-76408397 GCGTATCTGCAAAATGAGCATGG - Intronic
1152227315 17:79098464-79098486 CTTCATCTGCAAAATGGGGAGGG - Intronic
1152498629 17:80693478-80693500 CCTCTTCTGCAAATTAAGGAAGG + Intronic
1152585553 17:81187997-81188019 CCCTGTCTGCAAAAGGGGGAAGG + Intergenic
1152690236 17:81714664-81714686 CCTCATCTGCAGAAGGAGAATGG + Intronic
1153027519 18:684973-684995 CCCCATCTTCCAAAGTAGGAGGG + Intronic
1153170369 18:2309519-2309541 CTCCATCTGCAAAATGGAGCTGG - Intergenic
1153519889 18:5941664-5941686 CCGCATCTGTAAAGTGAGGGTGG + Intergenic
1153680126 18:7492541-7492563 CCTCATTTGTAAAATGGGGATGG + Intergenic
1154391601 18:13941331-13941353 TCCCTTCAGCAAAATGAGGGTGG - Intergenic
1155137014 18:23005858-23005880 TTGCATCTGCATAATGAGGAGGG - Intronic
1155346278 18:24860264-24860286 CAGCATCTGTAAAATGGGGATGG + Intergenic
1155357844 18:24970722-24970744 CCCCATCTACAAAACCAGCAAGG - Intergenic
1155403045 18:25459587-25459609 ACCCATCTACAAAGTGAGGCGGG + Intergenic
1155616010 18:27722446-27722468 CCCCACCTACAAAATGAGAATGG + Intergenic
1156232884 18:35172123-35172145 CCCCATTTGCCATATGAGGAAGG + Intergenic
1156351267 18:36303336-36303358 CCCCATCTGCACAGAGAGCATGG - Intronic
1156384703 18:36594584-36594606 CCTCATCTGCACAATGGGGATGG + Intronic
1156634625 18:39012336-39012358 TCCCATCTTCAAAAGGAGAAGGG - Intergenic
1157185312 18:45535495-45535517 CCTCATCTGTAAGATGAGGATGG - Intronic
1157462699 18:47914785-47914807 ACACATCTGAAAAATAAGGAAGG - Intronic
1157491526 18:48127121-48127143 CCCCATTTGCAAAATGGGGATGG - Intronic
1157514371 18:48300460-48300482 CCTCAGCTGCAAAATGAGGGTGG - Intronic
1157528255 18:48401571-48401593 CCCCATCTGCAGTATGGGGATGG + Intronic
1157562213 18:48656365-48656387 CCCCATCAGTAAAATGGGGATGG + Intronic
1157587926 18:48817085-48817107 CCCCATGTTTTAAATGAGGATGG - Intronic
1157597664 18:48873684-48873706 CCCCATCTGTAAAAGAAGGATGG + Intergenic
1157628794 18:49075636-49075658 CCCCACCATCAAAATGAAGATGG - Intronic
1158667876 18:59449210-59449232 CCTCATCTATAAAATGGGGATGG + Intronic
1158911401 18:62066357-62066379 CCTCATCTGTAAAATGGAGATGG + Intronic
1159095155 18:63893861-63893883 CCTCATCTGTAAAATGAGTACGG - Intronic
1159442758 18:68502848-68502870 CCTTGTCTGCAAAATGGGGATGG - Intergenic
1160086513 18:75781744-75781766 CCCCATGTGCAAACTGGGGCTGG + Intergenic
1161475515 19:4482771-4482793 CCTCATCTGCAGAATCAGGCTGG + Intronic
1161631843 19:5360925-5360947 CCCCATCTGTAAAATGGGGCTGG - Intergenic
1161692568 19:5745320-5745342 CTACATCTTCAAAATGAGGCCGG + Intronic
1162448954 19:10742807-10742829 CCCCATCTGCAAAACAGGGTTGG + Intronic
1162552064 19:11363627-11363649 CCTTATCTGAAAAATGGGGATGG + Intronic
1162602087 19:11676946-11676968 CCCCGTCTGGGAAGTGAGGAGGG - Intergenic
1162894594 19:13757727-13757749 ACCCATCTGCAAAATTCAGATGG + Intronic
1162981916 19:14245967-14245989 CCTCATTTATAAAATGAGGATGG - Intergenic
1163791037 19:19306209-19306231 CCCCATCTGTAAAATCAGGGTGG - Intronic
1163945570 19:20530726-20530748 CCCAGTCTGGAAAGTGAGGAGGG - Intergenic
1164052113 19:21592563-21592585 CTTCATCTGCAAAATGGAGATGG - Intergenic
1164298491 19:23937330-23937352 CCCCATCTGGGAAGTGAGGAGGG - Intronic
1164587301 19:29484055-29484077 CATCATCTGCAAAATGGGGCTGG - Intergenic
1164647260 19:29868317-29868339 CCTCATTTGCAAAATGGGAATGG - Intergenic
1164703336 19:30301926-30301948 CCACCTCTGCACACTGAGGAGGG + Intronic
1165123986 19:33581149-33581171 TCTCATCTGCAAAGTGAGGTGGG + Intergenic
1165394542 19:35557263-35557285 CCTCATCTGTAAGATGAGAATGG - Intronic
1165906195 19:39196352-39196374 CCCCCTCTGCAGAGTGGGGAGGG + Intergenic
1166066471 19:40362260-40362282 CTCCATCTGCAAAATGGGCATGG - Intronic
1166156953 19:40920906-40920928 CTCCATCTATAAAATGGGGATGG + Intergenic
1166164659 19:40978867-40978889 TCTCATCTGTAAAATGAGAATGG - Intergenic
1166166020 19:40989380-40989402 CTCCATCTATAAAATGGGGATGG + Intergenic
1166651530 19:44578892-44578914 CCCCATTTTCCAGATGAGGATGG - Intergenic
1166654702 19:44602228-44602250 ACCCATCTGCATAATGAAGCTGG + Intergenic
1166816672 19:45550512-45550534 CCCCAGCTGCAGAGTGAGGAGGG - Intronic
1167145181 19:47677080-47677102 CCTCGTCTGTGAAATGAGGAAGG + Intronic
1167457609 19:49605673-49605695 CCCCATCTGTAAAATGGGGATGG - Intronic
1167649313 19:50720727-50720749 CCCCCTCTGGAAAATGGGGATGG - Intergenic
1167659828 19:50790176-50790198 CCCCATCGGTACAATGGGGATGG + Intergenic
1167660345 19:50792452-50792474 TCCCATCTGCACAGTGGGGATGG + Intronic
1168150510 19:54445055-54445077 GTCCATCTGCAAGCTGAGGAAGG - Intergenic
1168397390 19:56060248-56060270 CCCCATCTGTGAAATGGGGGCGG + Intronic
1168467795 19:56618283-56618305 CCTCATCAGCAAAATGAGGATGG + Intronic
1168490498 19:56804840-56804862 CCTCATCTGTAAAATGGGGCTGG - Intronic
1168492289 19:56821160-56821182 CCTCATCTGTAAAATGAATATGG - Intronic
925189861 2:1874289-1874311 CCCCATCTGTGAAATGGGCACGG + Intronic
925195002 2:1915595-1915617 CCTCATCTGCAAAGTGAGGCAGG - Intronic
925295677 2:2775009-2775031 CCTCAGCTGTAAAATGAGGATGG - Intergenic
925309229 2:2870465-2870487 CCCTCTGTGTAAAATGAGGAGGG - Intergenic
925699408 2:6618684-6618706 TCCCATCTGCAAAACAAGGATGG + Intergenic
925873086 2:8287617-8287639 TCCCAGCTGCCAAATGAGAATGG + Intergenic
926049943 2:9738238-9738260 CCTCATCTGTGAAATGGGGATGG - Intergenic
926088500 2:10035142-10035164 TCTCATCTGTAAAATGGGGATGG - Intergenic
926539456 2:14156958-14156980 CCCCATCTCACAGATGAGGAGGG + Intergenic
926737730 2:16086621-16086643 CCACATCTGTCAAATGAAGAGGG - Intergenic
926809012 2:16740075-16740097 CTTCATCTATAAAATGAGGAAGG - Intergenic
927344256 2:22018924-22018946 CTTCATCTGCAAAATAAGGATGG + Intergenic
927853227 2:26512902-26512924 CCCCATCTCACAAATGGGGAGGG + Intronic
927856589 2:26531374-26531396 CCCCATCTGTGAAAAGAGGGGGG + Intronic
927879719 2:26681944-26681966 CCCCATCTGCCTCAAGAGGATGG - Intergenic
927973955 2:27323708-27323730 CTGCATCTGTAAAATGAGGGAGG + Intronic
928201498 2:29250295-29250317 CCTCATTTGTAAAACGAGGATGG + Intronic
928886687 2:36157289-36157311 CCCTTTCTGCCAAGTGAGGAAGG - Intergenic
929323036 2:40568961-40568983 TTCCACCTGTAAAATGAGGATGG + Intronic
930396449 2:50828727-50828749 CCCAGTCTGGAAAGTGAGGAGGG - Intronic
931188096 2:59973284-59973306 CCTCATCTGTAAAATGGGGATGG - Intergenic
931486150 2:62694708-62694730 CCTCATCTGTAAAATGGGAATGG - Intronic
931523498 2:63126419-63126441 CTTCATCTGTAAAATGAGAATGG - Intronic
931633658 2:64323034-64323056 CACCAGCTGCAAAATGGGGGTGG + Intergenic
931859326 2:66337665-66337687 CCTTATCTGTAATATGAGGAGGG + Intergenic
932266385 2:70370753-70370775 CCTCATCTGTAGAGTGAGGATGG + Intergenic
933287177 2:80397348-80397370 CCTCATCTGTAAAATGAGCATGG - Intronic
934301662 2:91780308-91780330 CCCCATCTGTAAAACGAGTCAGG + Intergenic
934687602 2:96333298-96333320 CCCCGTCTATAAAATGGGGAAGG - Intergenic
934717663 2:96552863-96552885 CCCCATCTCCACAATGAGGAAGG - Intergenic
934815173 2:97319509-97319531 CTCCCTCTGCAAAATGAACAAGG + Intergenic
934822522 2:97388974-97388996 CTCCCTCTGCAAAATGAACAAGG - Intergenic
934934439 2:98454449-98454471 TCTCATCTGTAAAATGGGGAAGG + Intronic
935129404 2:100250071-100250093 CCCCATCTGCAAAATGAGGAGGG + Intergenic
935359272 2:102233674-102233696 TCTCATCTGTAAAATGGGGATGG + Intronic
936287566 2:111192567-111192589 CCCCATCTAAAAAGTGGGGATGG - Intergenic
936410484 2:112254016-112254038 TCCCATCTGTAAAACGAGGACGG + Intronic
936434011 2:112487641-112487663 TCTCATCTGTAAAATGGGGATGG + Intronic
937215501 2:120310262-120310284 CCTCATCTGTAAAATGAGGGGGG + Intergenic
937239335 2:120450256-120450278 ACTCATCTGCCAAATGAGGCTGG + Intergenic
937342201 2:121098482-121098504 CCCCATCTGTAAAATGGAGATGG + Intergenic
937426234 2:121801394-121801416 TCCCATCTGGAATATGAGGGAGG - Intergenic
937491837 2:122377592-122377614 CCTTATTTGCAAAATGAGGAGGG + Intergenic
937850111 2:126624370-126624392 CCTCATCTGGAAAATAAGGATGG - Intergenic
938667884 2:133558010-133558032 TCCCATCTGCAAAGTGAAGGGGG - Intronic
939620493 2:144413025-144413047 CCTCATCTGTAAAATGAGCCAGG + Intronic
940345532 2:152624161-152624183 CTCCATCTCAAAAAAGAGGAAGG - Intronic
940888361 2:159011101-159011123 TCTCATCTGTAAAATGGGGATGG - Intronic
941049853 2:160720678-160720700 CCCCACCTGTAAAATGGAGATGG + Intergenic
941203510 2:162543743-162543765 CCTCATCTATAAAATAAGGAAGG + Intronic
941907818 2:170734077-170734099 CCTTATCTGAAAACTGAGGAAGG + Intergenic
943235949 2:185319764-185319786 CCTTATCTGCAAATTGAAGATGG + Intergenic
943272515 2:185825312-185825334 CCTCATCTATAAAATGAGTATGG - Intronic
943418473 2:187637261-187637283 CCCCATCTGGGAAGTGAGGAGGG - Intergenic
943418497 2:187637335-187637357 CCCCATCTGGGAAGTGAGGAGGG - Intergenic
943418521 2:187637409-187637431 CCCCATCTGGGAAGCGAGGAGGG - Intergenic
944611132 2:201409150-201409172 CCTCATCTGTAAAATGGAGAAGG + Intronic
944633062 2:201647194-201647216 TCTCATCTGTAAAATGATGATGG - Intronic
944797866 2:203206840-203206862 CCCCGTCTGGGAAGTGAGGAGGG + Intronic
944977128 2:205066591-205066613 CTTCATCTGTAAAATGAGAAAGG + Intronic
944988996 2:205212947-205212969 CCCCATCTGTAAAATGGCGATGG - Intronic
945112062 2:206369340-206369362 CCTCATTTGTGAAATGAGGAAGG + Intergenic
945182323 2:207104609-207104631 CCTCATCTAGAAAATGGGGAGGG - Intronic
945665847 2:212741311-212741333 TCTTATCTGCAACATGAGGAAGG - Intergenic
946046099 2:216822372-216822394 CCTAATCTGGAAAATGGGGATGG - Intergenic
946465860 2:219911518-219911540 CCTCATTTGCAAAATAAAGATGG + Intergenic
946748634 2:222870863-222870885 CCCCTTTTGGACAATGAGGAGGG + Intronic
946809748 2:223511167-223511189 CCCCATCTGCTATCTGAAGAAGG + Intergenic
947221185 2:227794163-227794185 GGCCATCTGCAAAGTTAGGAGGG + Intergenic
948033325 2:234837482-234837504 CCTCATCTGTAAAATGCAGAGGG - Intergenic
948243251 2:236456269-236456291 CCTCATCTTAAAAATGAGGTAGG - Intronic
948295023 2:236854213-236854235 CCCTATCCGTAAAATGGGGATGG - Intergenic
948447064 2:238041001-238041023 CCCCATCTGGAAAATGAGAAGGG + Intronic
948685352 2:239666432-239666454 CCCCATTTGTAGAATGACGATGG + Intergenic
948907520 2:240986851-240986873 CCCCATCTGTGAAGTGGGGAAGG + Intronic
1168803029 20:655645-655667 CCCCATCTATCAAATGGGGATGG - Intronic
1168910787 20:1445123-1445145 CCCCATCTTTAAAATGAAGAAGG + Intronic
1169642317 20:7767735-7767757 GCACAACTGCAAAATAAGGATGG + Intergenic
1170415011 20:16130263-16130285 CTTCATCTGCAAAATGAAGGTGG - Intergenic
1171902356 20:30869341-30869363 CCTCCTCTACAAAATAAGGATGG + Intergenic
1172116802 20:32577879-32577901 CCTCATCTGGAAAATGGGAATGG - Intronic
1172311468 20:33921571-33921593 TCTCGTCTGTAAAATGAGGACGG - Intergenic
1172330885 20:34075391-34075413 CCCCATATGCCAAATGAGGATGG - Intronic
1172406023 20:34689897-34689919 CCCCTTCTGCAGAATCTGGATGG - Intergenic
1172505522 20:35459213-35459235 CCTTATCTGCAAGATGAGGGGGG + Intronic
1172557129 20:35852074-35852096 CCTCATCTGCAAAATAAGAATGG - Intronic
1172840384 20:37899512-37899534 CTCCATCTGTAAAAGAAGGAAGG + Intergenic
1173153176 20:40585094-40585116 CCCCATCTGTAAAATAGGGATGG + Intergenic
1173307669 20:41865392-41865414 CCCCATCTCCCAAATGAGATGGG + Intergenic
1173556858 20:43972607-43972629 CCTCATCTGTTAAATGGGGATGG - Intronic
1173605135 20:44326566-44326588 TCCCATCTGTTAAATGGGGATGG - Intergenic
1173644009 20:44622427-44622449 CCTCATTTGTAAGATGAGGACGG + Intronic
1173912404 20:46680022-46680044 CCCCATCTGTAAAATGGGTATGG + Intronic
1173958621 20:47053979-47054001 CCCCATTTGTAAAATGGGGATGG + Intronic
1174067261 20:47874629-47874651 TTTCATCTGCAAAATGGGGACGG + Intergenic
1174157036 20:48522242-48522264 TTTCATCTGCAAAATGGGGACGG - Intergenic
1174187728 20:48719078-48719100 TCCCATCTGTAAAATGGGCATGG - Intronic
1174365464 20:50053726-50053748 TCTCATCTGTAAAATGGGGATGG + Intergenic
1174385501 20:50186535-50186557 CCCCATCTGCCAAGTGGGGCTGG - Intergenic
1174563246 20:51446100-51446122 CCCCATCCGTAAAATGGGAAGGG + Intronic
1174706811 20:52664751-52664773 TCTCATCTGCAAGATGAGGTGGG - Intergenic
1174948794 20:55020192-55020214 CCCCATGTTATAAATGAGGAAGG + Intergenic
1175019405 20:55828337-55828359 CCTAATCTGCAACATGGGGATGG + Intergenic
1175169297 20:57068813-57068835 CCCTATCTGTAAATGGAGGAGGG + Intergenic
1175259423 20:57665213-57665235 CTTCATCTGCAAAATGGGCATGG - Intronic
1175465749 20:59190506-59190528 CCAGATCTGCAAAATGGGCAAGG - Intergenic
1175679248 20:60973499-60973521 CCCCATCTGTGAAATGAGTATGG + Intergenic
1175709557 20:61208307-61208329 CCTCATCTACAAAATGGGGGTGG + Intergenic
1176096618 20:63347278-63347300 GCCCATCTGCAAAACGGGGAGGG - Intronic
1176245794 20:64095887-64095909 TCCCATCTGGAAAGTGAGCAAGG + Intronic
1177918100 21:27116047-27116069 CCTCTTCTATAAAATGAGGAAGG + Intergenic
1178089091 21:29142796-29142818 CCTCCTCTGCAAAATGGGAAGGG - Intronic
1178153252 21:29820695-29820717 CCCCTTTTCAAAAATGAGGATGG - Intronic
1178303891 21:31474427-31474449 CCTCATCTGTAAGATGAGGATGG + Intronic
1178471482 21:32897433-32897455 CCTCATCTAGAAAACGAGGATGG - Intergenic
1178704522 21:34862215-34862237 CCTCATCAGCAAAATGAGGGGGG + Intronic
1178883205 21:36464776-36464798 CCCCATGTGTAAAAAGGGGATGG - Intronic
1179000183 21:37450441-37450463 CCCCCTCTGTAAAGTGAGGTGGG + Intronic
1179325105 21:40334635-40334657 CCCCATCTCTAAAAAGAAGAAGG - Intronic
1179426231 21:41280644-41280666 CCACATCTGCGGAATGTGGAAGG + Intronic
1179511608 21:41877475-41877497 CCTCATTTGCAAAGTGTGGATGG - Intronic
1179988091 21:44932277-44932299 CCCCATCTCTATAATGGGGACGG - Intergenic
1181200960 22:21216747-21216769 CCCCATCTGTAAAATGAGTCAGG - Intronic
1181619325 22:24077751-24077773 CCCAATCAGCATAAGGAGGATGG - Intronic
1181700781 22:24620226-24620248 CCCCATCTGTAAAATGAGTCAGG + Intronic
1181782283 22:25201843-25201865 CCCCATGTTTGAAATGAGGATGG + Intronic
1181862304 22:25828597-25828619 CCCCAACTGTTAAATGAGGATGG - Intronic
1181943424 22:26496716-26496738 CCCAAGCTGCAAAAGGAGGTGGG - Exonic
1181956086 22:26589189-26589211 CCCCATCTGTAAAAGGGGAAGGG + Intronic
1181987218 22:26808529-26808551 CCCCATCCTTAAAATGGGGATGG - Intergenic
1182068722 22:27448266-27448288 CCTCATCTGCAGACTGAGCAGGG + Intergenic
1182086381 22:27563917-27563939 CCCCATCTGTAAAATGAAGAGGG + Intergenic
1182088823 22:27580265-27580287 CCTCATCTGCAAGCTGAGCAGGG - Intergenic
1182096055 22:27626808-27626830 CCTCATCTGCAAAATGGAGTTGG - Intergenic
1182126672 22:27821065-27821087 CCACGTCTGGAAATTGAGGACGG + Intergenic
1182247554 22:28971615-28971637 CCTCATCTGTAAAATAAGAATGG - Intronic
1182334603 22:29575371-29575393 CCCCATCTGTCAAATGAGCAGGG + Intronic
1182412058 22:30195654-30195676 CCTCATCTACAAAATGAGATTGG - Intergenic
1182823786 22:33244373-33244395 CCTCATCTGCACAATGGGGATGG - Intronic
1182996244 22:34815478-34815500 CCTCATCTACAACATAAGGATGG - Intergenic
1183069516 22:35386575-35386597 GCCCAGCTGCGAAGTGAGGAGGG + Intronic
1183099302 22:35574246-35574268 CCCCAGCTCCAAAATCAAGATGG + Intergenic
1183234168 22:36604633-36604655 CTCCATCAGCAAAAAGATGATGG + Intronic
1183346497 22:37311187-37311209 CCCCATCTGTAAAATGGGCATGG - Intronic
1183368809 22:37420863-37420885 CCTCCTCTGGAAAATGAGGATGG + Intronic
1183414761 22:37675854-37675876 CCACATCTGTAAAATGGGGGTGG + Intronic
1183424664 22:37733115-37733137 CCCCTTCTGAAAAATGGGGATGG - Intronic
1183740492 22:39666138-39666160 CCTCTTCTGCAAAATGGGTAAGG + Intronic
1184095221 22:42312722-42312744 CCCCATCTGCAAGATGTGACTGG + Intronic
1184330339 22:43823255-43823277 CTCCATCTGCAAAGTGAGGTGGG - Intergenic
1184658587 22:45954876-45954898 GCACACCTGCAAAATGAGGATGG - Intronic
1184674949 22:46036458-46036480 CCCCTTCTGCACAGGGAGGAAGG + Intergenic
1184813653 22:46854266-46854288 CCTCATTTGTAAAATGGGGATGG + Intronic
1185196125 22:49470591-49470613 CCCCAACTGCGGAAGGAGGACGG + Intronic
1185359058 22:50394256-50394278 CCCCATGTGAGAAGTGAGGAGGG + Intronic
949510041 3:4759540-4759562 CCTCATCTGTGAAATGTGGAAGG + Intronic
949725259 3:7036896-7036918 CTCCATCTACAAAATGAGTCTGG + Intronic
949928599 3:9060809-9060831 CTCCATCTGCTAGATGAGTAAGG + Intronic
949936820 3:9122086-9122108 CCCCATCGTAAAGATGAGGATGG - Intronic
950114102 3:10439281-10439303 CCCCATCTGGAAAATAAAGAAGG - Intronic
950127248 3:10517407-10517429 CCCCATATTCAAAATGAGAGGGG + Intronic
950154651 3:10712528-10712550 CCTCAACTGCAAAATGGGGATGG - Intergenic
950198911 3:11029012-11029034 CCCCTTCTGGAAAATGGAGAAGG - Intronic
950374560 3:12560060-12560082 CCTCATCTGTGAAATGAGGATGG + Intronic
950438632 3:12994633-12994655 TCCCATCTGCGAACTGGGGACGG - Intronic
950463224 3:13138085-13138107 CTCCATATGCAAAATGAGAGGGG + Intergenic
950521382 3:13499949-13499971 CCTCATCTGTAAAATGGGGATGG + Intronic
950569194 3:13789529-13789551 CCCCATCTGTAGAACAAGGAGGG + Intergenic
950648636 3:14393437-14393459 GTCCATCTGTAAAATGAGGATGG - Intergenic
950669030 3:14514153-14514175 CCTCATCTGTAAAATGGGGCTGG + Intronic
950711034 3:14812968-14812990 TCCCATCTATAAAATGGGGATGG - Intergenic
951589442 3:24247434-24247456 CCCCAACTGTAAAATGTGGATGG - Intronic
951977246 3:28526073-28526095 CCTCATATGTAAAATGGGGATGG + Intronic
951987882 3:28641137-28641159 CCCATTCTGGAAAATGGGGATGG - Intergenic
952676945 3:36043990-36044012 CTCCATCTGAAAAAAAAGGAGGG - Intergenic
953312655 3:41894677-41894699 CCTCATCTGTAAAATTGGGATGG - Intronic
953591709 3:44262923-44262945 CCTCACATGCAAAATGAGGGTGG - Intronic
953746677 3:45579631-45579653 CCATTTCTGCCAAATGAGGATGG + Intronic
953799600 3:46012243-46012265 CCCCTTCTTCTAGATGAGGATGG - Intergenic
953861749 3:46550216-46550238 CCTCATCTGCAAATTAGGGATGG + Intronic
953928170 3:46992822-46992844 CCCCTTCTGAGAAATGAGGTAGG - Intronic
954002374 3:47567709-47567731 CCCCATCTATAAAAGGAAGAAGG + Intronic
954685163 3:52366324-52366346 CCTCATCTATAAAATGAGGATGG - Intronic
954845177 3:53549495-53549517 CCTCAGCTGTAAAATGAGGTAGG + Intronic
954914671 3:54138718-54138740 CCCCAAATGCAGAATGAGGATGG - Intronic
955066815 3:55540600-55540622 CCCCATCTGTAAAACGAAGGAGG + Intronic
955842573 3:63128012-63128034 CCTCATCTGTGAAATGAGCATGG - Intergenic
955867801 3:63403545-63403567 TCTCATCTGTTAAATGAGGATGG - Intronic
956093481 3:65692562-65692584 CCTTATCTACAAAATGGGGATGG - Intronic
956151253 3:66245354-66245376 CCCCTTCTGCACAATGCTGAGGG + Intronic
956170893 3:66432568-66432590 CCCCATCTGTAAAATGGGGACGG - Intronic
956206612 3:66761554-66761576 CCTCATATGTAAAATGAGAAGGG + Intergenic
956733761 3:72219957-72219979 CCTCATCTGTAAAATGGGGCAGG + Intergenic
956740984 3:72275878-72275900 CCTCTTCTGTAAAATGGGGATGG - Intergenic
956741720 3:72280732-72280754 CTTCATCTGTAAAATGGGGATGG - Intergenic
956974009 3:74559213-74559235 TCTCAACAGCAAAATGAGGAAGG + Intergenic
956986406 3:74706424-74706446 TCTCATCTGCAAAATGGGAAGGG + Intergenic
957385049 3:79485661-79485683 CTGTATCTGCAAAATGGGGATGG - Intronic
957764432 3:84603675-84603697 TCACCTCTGCAAAATGAGAAGGG + Intergenic
959361596 3:105400873-105400895 TCCCATCTGTAAAATGGGGAAGG + Intronic
959810171 3:110608807-110608829 CCACATTAACAAAATGAGGAAGG + Intergenic
960997238 3:123348281-123348303 GCTCGTCTGTAAAATGAGGATGG + Intronic
961134799 3:124500409-124500431 CCCTATGTGAGAAATGAGGAGGG - Intronic
961457122 3:127029786-127029808 CCCCATCTGAAAGCTGGGGATGG - Intronic
961818226 3:129562047-129562069 TCCCATCTGTAAAATGGGGAGGG + Intronic
962074911 3:132071330-132071352 CACCATCTCAAAAGTGAGGATGG - Intronic
962869666 3:139477014-139477036 TCTCATCTGTAAAATAAGGATGG - Intronic
964091052 3:152876012-152876034 TTCCATCTGTAAAATGAGGGTGG - Intergenic
964428235 3:156575849-156575871 CACCATCTGCAGCATGAGGCTGG - Intergenic
965730404 3:171765663-171765685 CTTGATCTGTAAAATGAGGAAGG + Intronic
966739169 3:183216132-183216154 TACCATCTGCAAAGTGAAGAAGG + Intronic
966890763 3:184406012-184406034 CCTCATCTGCAACATAGGGATGG - Intronic
967316953 3:188158693-188158715 TCTCATCTGCAAAATGAGACTGG - Intronic
967877534 3:194277297-194277319 CCCACCCTGCAACATGAGGAAGG + Intergenic
968846120 4:3042439-3042461 CCTCAGCTGCAGAATGAAGATGG + Intergenic
968954414 4:3710930-3710952 CCACACCTGCAAAATCAGGGTGG - Intergenic
969063345 4:4456954-4456976 CCTCATTTGTAAAATGAGGGAGG + Intronic
969075973 4:4577957-4577979 CCCCTTCTGGAAAATGAAGGTGG + Intergenic
969355864 4:6625260-6625282 CCCCTTCTGCCATGTGAGGACGG - Intergenic
969520618 4:7675825-7675847 CCCCATCTCTAAAATGGGGATGG - Intronic
969524327 4:7696494-7696516 CCTCATCTGTAACATGAGGTTGG + Intronic
969578484 4:8050309-8050331 CCCCTTCTGCACCATGGGGATGG - Intronic
970006051 4:11411933-11411955 TCCCATCTGAAATATGGGGATGG + Intronic
970206317 4:13659039-13659061 CATCAGCTGTAAAATGAGGAGGG - Intergenic
970795976 4:19914058-19914080 CTCCATTTACAAAATGAGGGAGG + Intergenic
970991307 4:22216338-22216360 CCTCAGCTATAAAATGAGGATGG + Intergenic
971036895 4:22703387-22703409 CCTTATTTGCAAAATGAGAACGG + Intergenic
971297595 4:25411662-25411684 TCTCATCTGTAAAATGAAGATGG + Intronic
971493840 4:27242821-27242843 CCCAAGCTGTAAAATGGGGAGGG + Intergenic
972456634 4:39262082-39262104 CCCCATCAGTAAAGTGAAGAAGG - Intronic
972654332 4:41050372-41050394 TCTCATCTGTAAAATGGGGATGG - Intronic
972724144 4:41731522-41731544 TCTCATCTGTGAAATGAGGATGG + Intergenic
973177962 4:47231366-47231388 TTTCATCTGTAAAATGAGGAGGG + Intronic
973960213 4:56102393-56102415 CCTCATTTGTAAAATGAAGAAGG - Intergenic
975193078 4:71489427-71489449 TCCCATCTGCAACATCGGGATGG + Intronic
975438664 4:74384185-74384207 CTTCATCTGTAAGATGAGGATGG + Intronic
975471351 4:74772689-74772711 CCGCATCTGCAACCTGAGGATGG + Intronic
975824939 4:78309486-78309508 TCCTATCTGGAAAATGAGAATGG - Intronic
976071565 4:81246216-81246238 CCTCATCTGTAAAATGAGTGTGG + Intergenic
976218693 4:82738871-82738893 CCTCATCTGTAAAATGGGGTTGG - Intronic
976781901 4:88769461-88769483 CCTCATCTGGAAAATGAAGATGG + Intronic
976793579 4:88907867-88907889 CCTCATCTGTAAAATCAGGGAGG - Intronic
977119442 4:93079465-93079487 GCCCATATGAAAAATTAGGAGGG - Intronic
978453161 4:108859206-108859228 TCCCATCTACAGAATGAGGATGG - Intronic
978634800 4:110791554-110791576 CATCATCTGCACAATGAGCAGGG + Intergenic
979442526 4:120768338-120768360 CCTCATCTAGAAAATGAGAATGG + Intronic
980423228 4:132592234-132592256 CTCCATCTCCATGATGAGGAGGG - Intergenic
980794674 4:137665623-137665645 CCACATCAGTAAAATGAAGATGG + Intergenic
984408803 4:179369541-179369563 CCTCAACTGCAAAAGGACGAGGG - Intergenic
984706745 4:182852769-182852791 CCCCATCTGGAAATGGAGCAGGG - Intergenic
985000909 4:185481587-185481609 GGCCATCTGCAGAATGAGGAGGG - Intergenic
985312832 4:188620315-188620337 GCCCTTCTGAAAAATGAGGCTGG - Intergenic
985970830 5:3377270-3377292 CCCCCTCTGTAAAACCAGGAGGG + Intergenic
986399901 5:7370558-7370580 CCCTATCTGCTAAGGGAGGAGGG - Intergenic
986592994 5:9390920-9390942 CCACATCTGCAAAATGGCAAAGG - Intronic
986633583 5:9798579-9798601 CCCCATCTGTAAAATGCTGAGGG + Intergenic
987305303 5:16631999-16632021 CCCCAGCTGCCAAGTGAGGAAGG - Intergenic
987333540 5:16878021-16878043 CTCCATCTGTAAAATGGGAATGG - Intronic
987873663 5:23651632-23651654 CCTCAGCTGCAATATGAGGTTGG - Intergenic
988252863 5:28782642-28782664 GGCCATCTGCAAGCTGAGGAAGG - Intergenic
988665401 5:33321860-33321882 CCACTTCTGCATGATGAGGAAGG + Intergenic
989110451 5:37902109-37902131 CCTCCTCTCTAAAATGAGGAAGG + Intergenic
989717310 5:44479426-44479448 CCACATATGCACTATGAGGATGG + Intergenic
990309318 5:54522736-54522758 ACCCAGCTGCAAAATGAGGGTGG + Intronic
990382795 5:55232967-55232989 CTCCATCTGTAAAATGAGGCCGG + Intronic
990510629 5:56486400-56486422 CCTCATCTGTAAAATGGGGAGGG - Intergenic
990821862 5:59850371-59850393 GCCCATTTGTAAAATGAGCATGG + Intronic
991019913 5:61969785-61969807 CTCCATCTGTAAAATGAAAATGG - Intergenic
991513329 5:67404908-67404930 CCTCATCTGTAAAATGTAGATGG + Intergenic
992030388 5:72715287-72715309 CCTCATCAGCAATGTGAGGAAGG - Intergenic
992486482 5:77201929-77201951 CACCACCTGCAAGTTGAGGAGGG - Intergenic
992712613 5:79475186-79475208 CCTCATCTTCAAAAGGGGGATGG - Intronic
993435771 5:87891760-87891782 CTCCATCAGCAACATAAGGAAGG - Intergenic
995045266 5:107639448-107639470 CCTTAACTGCAAAATGAAGATGG + Intronic
995307263 5:110667689-110667711 CCTCACCTGTAAAATGAGAATGG + Intronic
995441146 5:112193599-112193621 TCTCTTCTGAAAAATGAGGAAGG - Intronic
995476714 5:112555441-112555463 CCTCATCTGCAAAGGAAGGAGGG + Intergenic
995742409 5:115368828-115368850 CCCCATCTTCAATCTGGGGAAGG + Intergenic
996824442 5:127665403-127665425 CCTCATCTGTAAAATGGGCATGG + Intergenic
997398370 5:133582344-133582366 CCTCATCTGCAAAATGAGGTAGG + Intronic
998157207 5:139793865-139793887 CCTCATCTGCCCAATGAGGATGG - Intergenic
998480224 5:142457025-142457047 CTCCACTTGTAAAATGAGGATGG - Intergenic
998906461 5:146910548-146910570 CCTCATCTGCAAAAGGGTGATGG + Intronic
998923078 5:147092314-147092336 CCCCATATGCAAATGGAGAAAGG + Intergenic
999095850 5:148977590-148977612 CCTCATCTGTAAAATGGGGTTGG - Intronic
999141150 5:149362950-149362972 CTCCATCTGTAAAATGAGATTGG - Intronic
999571305 5:152923037-152923059 CCTCATCTGTAATATGAGGGTGG - Intergenic
999861278 5:155649299-155649321 CCTCATCTGTAAAATGGGGATGG + Intergenic
1000104671 5:158048080-158048102 CCTCATCTGCAAAATGGAGACGG + Intergenic
1000327259 5:160181819-160181841 CCCCATTTGTAACATGAGGCAGG - Intergenic
1000776760 5:165429468-165429490 CTCCATCTAGAAAATGAGGACGG - Intergenic
1000959081 5:167577989-167578011 CCCCATCAGCAAAATCAGCGTGG + Intronic
1001037387 5:168307164-168307186 CCTCATCTGCAGAATGGAGATGG - Intronic
1001127207 5:169030369-169030391 CCCCATCTGTAAATTGAAGAGGG - Intronic
1001219901 5:169891622-169891644 CCCCATCTCTATAATGAGGGGGG - Intronic
1001219977 5:169892243-169892265 CCCCATCTCTATAATGAGGGGGG - Intronic
1001308026 5:170589982-170590004 CCCCCTCTGCAAAATGGGAATGG + Intronic
1001953630 5:175833294-175833316 TCTCATCTGCAAAATCAGGGTGG - Intronic
1002045614 5:176540248-176540270 CCTCATCTGTAAAATGAGGCTGG - Intergenic
1002155084 5:177271415-177271437 CCTCATCTGCAAGATCAGGATGG - Intronic
1002295484 5:178228584-178228606 CCCCACCTGTAAAATGAAGATGG + Intronic
1002650194 5:180685909-180685931 CACCATCTCCAATCTGAGGACGG + Intergenic
1002763552 6:219705-219727 CTCCACCTGCAAAATGAGGTGGG - Intergenic
1002827911 6:790479-790501 CCTCATCTGTAAAATGAAGGTGG - Intergenic
1002833271 6:843602-843624 CACCATCTGCAAGCTGAGGACGG - Intergenic
1003247427 6:4395451-4395473 CCCAATCTGTAAAAAGATGATGG - Intergenic
1003458864 6:6310659-6310681 TCTCATCTGCAAAATGAAGTTGG + Intronic
1004007152 6:11647517-11647539 CCTCATCTGTAAAACGAGGAGGG - Intergenic
1004234942 6:13866803-13866825 TCCCATCTGCAAAATGGGAGTGG + Intergenic
1004240778 6:13919218-13919240 CCCCATCTATAAAATGAAGGTGG - Intergenic
1004326262 6:14676471-14676493 CCTCACCTGTAAAATGAGAAGGG + Intergenic
1004921286 6:20378653-20378675 CCCCATCTATAAAATAAGAATGG + Intergenic
1004928938 6:20443048-20443070 CCTCATCTGCCAAAAGAAGATGG - Intronic
1005363143 6:25051701-25051723 CCCTATCTGCAAAATGGTCACGG - Intergenic
1005735436 6:28741239-28741261 CCCTATCAGCAAAATGAGCCAGG - Intergenic
1006342451 6:33454142-33454164 CCCCGCCTGGAAACTGAGGACGG + Intronic
1007162730 6:39805300-39805322 CCTCATCTGTAAAATGGTGATGG + Intronic
1007452438 6:41950478-41950500 TCTCATTTGCAAAAGGAGGATGG + Intronic
1007918019 6:45579262-45579284 CCTCATCTGTAAAATGGGGATGG - Intronic
1007940867 6:45780213-45780235 CCTCATCTGCAAAAGGAGAGGGG - Intergenic
1007970138 6:46043780-46043802 ACCAATGTGAAAAATGAGGAGGG + Intronic
1008062492 6:47013355-47013377 CCTCATCTGTAAACTGGGGAAGG - Intronic
1008062586 6:47014171-47014193 TCTGATCTGCAAAATGAGGTTGG + Intronic
1008449017 6:51627751-51627773 CACCATACGCAAGATGAGGAGGG + Intronic
1008476125 6:51937715-51937737 CTCCATCTGTAAAATGGGCATGG + Intronic
1010311411 6:74390055-74390077 ACCTATCTGCAAAAAGAAGACGG - Intergenic
1012007002 6:93725614-93725636 CCCCATCTTAATACTGAGGAAGG - Intergenic
1012567920 6:100683190-100683212 CCCCATCTGGAAAATAATGTTGG - Intronic
1012662388 6:101918034-101918056 TCCCATCTATAAAATGAGGTGGG + Intronic
1012860943 6:104558802-104558824 TCCCATCTGTAAAATGAGGCTGG + Intergenic
1012862141 6:104572521-104572543 CCTCATCTGTAAAATGGGTATGG + Intergenic
1013067411 6:106697218-106697240 TCCCGTCAGTAAAATGAGGATGG - Intergenic
1013139054 6:107312521-107312543 CCCCATCTGTTAAATGGGGATGG + Intronic
1013290089 6:108712370-108712392 CCTCATCTGTAAAATGGGGGAGG + Intergenic
1013501935 6:110760784-110760806 CCTCATCTGTATAATGGGGATGG - Intronic
1013521487 6:110937777-110937799 CTCCATCTGTAAACTGAGGGTGG + Intergenic
1013607688 6:111765424-111765446 GGCCATCTGCAAGACGAGGAGGG + Intronic
1013691427 6:112649264-112649286 CCTCATCTGGAAAATAAAGAAGG + Intergenic
1014644505 6:123956491-123956513 TCCCCTCTGCAAGCTGAGGAGGG + Intronic
1015156280 6:130100228-130100250 TTTCATCTGTAAAATGAGGATGG - Intronic
1015531758 6:134227687-134227709 CCTCAACTGTAAAATGGGGATGG - Intronic
1015621531 6:135137003-135137025 CCCCATCTGCAGAATGGGTTGGG + Intergenic
1016840025 6:148516701-148516723 CCTCATTTTCGAAATGAGGATGG - Intronic
1016891768 6:149014526-149014548 CCCCATCTGCCAGATGTGGCTGG + Intronic
1017224097 6:152000175-152000197 CTTCATCTGCAAAATGAGAATGG - Intronic
1017657777 6:156646329-156646351 ACCCATCTGCCCAATGAGGTAGG + Intergenic
1018838571 6:167503031-167503053 CCTCACCTACAAAATGAGGATGG + Intergenic
1018919260 6:168160074-168160096 CCCTATCTATAAAATGAGGAGGG + Intergenic
1019278193 7:187035-187057 CCCCATCAGCAACAGGATGACGG - Intergenic
1019567459 7:1691515-1691537 CCTCATCTGTAAAATGGGCAGGG + Intronic
1019609961 7:1931325-1931347 CCTCATCTGGAGAATGGGGAGGG + Intronic
1019729996 7:2624289-2624311 CCCCAGCTGTAACAGGAGGAGGG - Intergenic
1019900104 7:4013835-4013857 CCCCTTCTTTGAAATGAGGAAGG - Intronic
1019972428 7:4551795-4551817 CCTCTTCTGCAAATTGAAGATGG + Intergenic
1020373361 7:7458729-7458751 ACTCATCTGAAAAATGGGGATGG - Intronic
1021744682 7:23726979-23727001 CTGCATCTCCAAAATGAGGAGGG - Intronic
1021798361 7:24280280-24280302 CTCCAGCTGCAATATGAAGAAGG + Intergenic
1021982319 7:26066889-26066911 CCTCATCTGTAAAATGGGGATGG - Intergenic
1022270805 7:28805790-28805812 TCCCATCTGTAAAATGGGGCTGG + Intronic
1022604027 7:31790739-31790761 ACCCATCTGCAAAATGATTTGGG - Intronic
1022673316 7:32476270-32476292 CCTACTCTGCAAAATGGGGATGG - Intergenic
1023183134 7:37506175-37506197 TCTCACCTGTAAAATGAGGATGG - Intergenic
1023633252 7:42184011-42184033 CCTCTTCTGTAAAATGGGGAGGG + Intronic
1023821714 7:43984312-43984334 CCCTATCTGTAAAATGAGGATGG - Intergenic
1023991764 7:45132919-45132941 CCCCATTTTACAAATGAGGAAGG - Intergenic
1024194508 7:47045842-47045864 CCTCACTTGCAAAATGAGGATGG + Intergenic
1024336864 7:48217622-48217644 TCTCATCTTCAAACTGAGGAAGG + Intronic
1025794302 7:64723618-64723640 CTGCATTTGCAAAATGAGGAAGG + Intergenic
1025807110 7:64844532-64844554 CTGCATCCGCAAAATGAGAAAGG + Intergenic
1026052918 7:66961851-66961873 CCTCATCTGTAAAACAAGGATGG + Intergenic
1026827475 7:73593583-73593605 TTCAATCTGCAAAATGGGGATGG - Exonic
1026854255 7:73742778-73742800 CCTCATCAGCAGAATAAGGACGG - Intergenic
1026935877 7:74254945-74254967 CCTCCTCTGCAAAATGGGGTGGG - Intergenic
1026978517 7:74513197-74513219 CCCCATCTGGAAAAGGCAGATGG - Intronic
1027109220 7:75423789-75423811 TCTCATCTGACAAATGAGGAAGG + Intronic
1027414836 7:77963879-77963901 CCTCATCTGTAAAATGAGATAGG + Intergenic
1028301139 7:89202657-89202679 CCTCATCTGGAAAATGAGGTTGG - Intronic
1028790546 7:94849210-94849232 CACCATCTCCGAAGTGAGGAGGG - Intergenic
1028916553 7:96265900-96265922 CCCCTTCTGCCATGTGAGGATGG - Intronic
1029349714 7:100004518-100004540 CCTCATCTGTAAAATAGGGATGG - Intergenic
1029527266 7:101102622-101102644 CCTCATCTTTAAAACGAGGATGG - Intergenic
1029749976 7:102537731-102537753 CCCTATCTGTAAAATGAGGATGG - Intergenic
1029767926 7:102636837-102636859 CCCTATCTGTAAAATGAGGATGG - Intronic
1030046802 7:105504548-105504570 CCTCATTTGTAAAATGAAGATGG - Intronic
1030676410 7:112390379-112390401 CCTCATCTGTAAAATGGGGATGG + Intergenic
1031071277 7:117164872-117164894 GCTCATCTGTAAAGTGAGGAGGG + Intronic
1032322539 7:130898016-130898038 CCTCATCTGTGAAATGGGGATGG - Intergenic
1032488575 7:132306837-132306859 CCCTTTCTGCAGAATGAGAAAGG - Intronic
1032518857 7:132527409-132527431 CCTCATCTGCTCAATGGGGATGG - Intronic
1032698481 7:134358289-134358311 TCTCATCTGTAAAATGGGGATGG + Intergenic
1033444618 7:141409452-141409474 CCTCATCTGTATAATGAGGATGG + Intronic
1033724866 7:144104158-144104180 CCCCATCTGCAAAATGGGGTGGG - Intergenic
1033755270 7:144393806-144393828 CTCCAAGTGCAAAATGAGGAGGG + Intergenic
1034544802 7:151782717-151782739 CCTCATCTGTAAAATGAGGATGG + Intronic
1035625472 8:1067555-1067577 TCCCATCTGGAAAATGGGCATGG - Intergenic
1035664148 8:1367986-1368008 CCCCATCTGGTGACTGAGGAGGG - Intergenic
1035905851 8:3509497-3509519 CCTCATCTTTAAAATGAAGAAGG + Intronic
1036729509 8:11249971-11249993 CCTCATCTGAAAAATGGGGATGG - Intergenic
1038331223 8:26611048-26611070 CCCCATCTGCAAAATAGAAATGG - Intronic
1038352214 8:26787032-26787054 CCTCATCTGTAAGATGAGGTTGG - Intronic
1038693053 8:29780682-29780704 CCCCATCTGTAAAATGAAGGTGG + Intergenic
1039426383 8:37489870-37489892 CCCCATTGGCAAGATGAGGGTGG - Intergenic
1039880350 8:41621700-41621722 CCCCATCTGTAATATGAGTCGGG + Exonic
1040566930 8:48575925-48575947 CCTCATCTGCAAAACAAGGTGGG - Intergenic
1041174338 8:55178366-55178388 CCCCGTCTGTAAAATGAAAATGG + Intronic
1041748761 8:61236766-61236788 CCTCATTTGTAAAATGAGGTCGG - Intronic
1042817416 8:72892574-72892596 CCTCATCTACAAAATATGGATGG - Intronic
1042892153 8:73624552-73624574 CCTCATCTGTAAAATGAAGTGGG - Intronic
1043180883 8:77085210-77085232 GGCCATCTGCAAACTGAGCAAGG - Intergenic
1043758105 8:84029743-84029765 CCCCATCTCCAAGGTGGGGAAGG + Intergenic
1044019573 8:87087833-87087855 CCTCATCTGTAAAATGAGAAAGG - Intronic
1044112851 8:88297774-88297796 CCTCATCTGTAAAATGAGTATGG + Intronic
1044409533 8:91868152-91868174 CCCCACCTTCAAACTGGGGATGG + Intergenic
1044843722 8:96360135-96360157 CCTGATCTGTAAAATGGGGAGGG - Intergenic
1044954852 8:97469418-97469440 CCTCATCTGTAAAATGGGGACGG + Intergenic
1044999981 8:97870175-97870197 CCTCATCTGTCTAATGAGGATGG + Intronic
1045425420 8:102061181-102061203 GACCATCTGCAGAATGAGCAGGG + Intronic
1046783121 8:118237034-118237056 TCCCATCTGTAAGTTGAGGATGG + Intronic
1046793141 8:118343079-118343101 CCTCATCTGTAAGATGAGAAGGG + Intronic
1046796048 8:118373296-118373318 CCAAATCTGCAAAATGAGACTGG + Intronic
1047156512 8:122325417-122325439 CCTCATCTTTAAAATGAGGATGG + Intergenic
1047411596 8:124628794-124628816 CCCCATCTTTAAAATGAGGATGG - Intronic
1047448507 8:124941446-124941468 CTTCACCTGTAAAATGAGGATGG - Intergenic
1047480079 8:125273765-125273787 CCCAATCTGCAATATGAGTGAGG - Intronic
1047521961 8:125601770-125601792 TCTCATCTGCAAAATGGTGATGG + Intergenic
1047555182 8:125921484-125921506 CTTCATCTGCAAAATGAGGTTGG + Intergenic
1047742081 8:127814587-127814609 CAACATCTGTAAAATGAGGATGG - Intergenic
1047761365 8:127957100-127957122 CCACATGTGCAAAATAGGGATGG - Intergenic
1047774642 8:128059755-128059777 CCCCATGTGTAAAATGGGGATGG - Intergenic
1048590229 8:135814497-135814519 CTGCATCTGTAAAATGATGATGG - Intergenic
1048609845 8:136010249-136010271 TCTCATCTCCAAAATAAGGACGG + Intergenic
1048901928 8:139047030-139047052 CCCTGTCTCCAAAAAGAGGAAGG - Intergenic
1048973923 8:139660795-139660817 TCCCATCTGGAAAATGGGAATGG - Intronic
1049245323 8:141559377-141559399 CCTCATCTAGAAAATGGGGACGG - Intergenic
1049985011 9:942142-942164 CCCCATCTCCAAAAAGACCAAGG - Intronic
1051141470 9:13984098-13984120 CCTCATCTGGAAAATAGGGATGG - Intergenic
1051273881 9:15380815-15380837 CCCTATCTGCACACTGAGGCGGG - Intergenic
1052488606 9:29133895-29133917 TCCCATCTGCTAAATGTGTATGG + Intergenic
1053313095 9:37031807-37031829 CCCTATCTGCCCAATGGGGAGGG - Intronic
1053428330 9:38025637-38025659 CCTCATCTGTGAAATGAGGATGG + Intronic
1054784720 9:69199889-69199911 CCCTATTTGTAAAATGGGGATGG + Intronic
1055416645 9:76091242-76091264 GCCCATCTGCAAGCAGAGGAGGG - Intronic
1055553347 9:77451234-77451256 CCTCATTGGTAAAATGAGGAGGG + Intronic
1055585658 9:77756812-77756834 CCTTATCTGTAAAATGAGAAGGG + Intronic
1056098813 9:83280886-83280908 CACCATCTGCCAAACCAGGAAGG + Intronic
1056166822 9:83948323-83948345 CCCCGTCTGGGAAGTGAGGAGGG + Intronic
1057082498 9:92183511-92183533 GTCCATCTGCAAAGTGAGTACGG - Intergenic
1057184990 9:93052520-93052542 TCCCATCTGTAAAATGGGGATGG + Intergenic
1057847908 9:98539545-98539567 CCCCTTCTACAAAATGAGGAGGG + Intronic
1058120634 9:101134969-101134991 CCTCATCTGCAAAATGGGGAAGG - Intronic
1058148540 9:101438407-101438429 CCCCATCTGTAAAATGAACTAGG + Intergenic
1058420050 9:104824795-104824817 CCTCATCTCTAAAATGGGGATGG - Intronic
1058632952 9:107008136-107008158 CCCCAACTGCATAATGAGAGGGG - Intronic
1058730634 9:107846641-107846663 CTACATCTGTAAAATGGGGATGG - Intergenic
1058907438 9:109493352-109493374 CCCCCTCTGTAAAATGGGGCTGG + Intronic
1059330978 9:113535674-113535696 GTCCAACTGCAAAATGAGAAAGG + Intronic
1059414599 9:114155344-114155366 CCCCATCTATACAAGGAGGAGGG + Intergenic
1059515863 9:114894609-114894631 CCTCATCTGCAACATGGGAATGG + Intronic
1059653542 9:116336797-116336819 CCCCATCTTTAAAATGATGATGG + Intronic
1059665265 9:116440326-116440348 TCCTATCTGTAAAATGAGGTGGG + Intronic
1059754801 9:117282500-117282522 CCCCATCTACAACATGAAGGTGG + Intronic
1059930604 9:119256693-119256715 CCTCATCTGTAAAATGGGGTGGG + Intronic
1059972243 9:119679641-119679663 ATCCATCTGTGAAATGAGGATGG + Intergenic
1060000968 9:119958372-119958394 CCACATCTGCAGAGTGAGGATGG - Intergenic
1060218602 9:121752881-121752903 CCTCATCTGAAAAAGGAGGAAGG - Intronic
1060513635 9:124251969-124251991 TCCCATCTGTAAAGTGAGGGTGG + Intergenic
1060562567 9:124558636-124558658 CCTCATCTGTAAAATGTTGAGGG - Intronic
1060588308 9:124800427-124800449 CCTCATCTGCCAAATGGGCAGGG - Intronic
1060598040 9:124859804-124859826 CCTCATCTGAAAAATGAGCATGG + Intronic
1060732793 9:126048793-126048815 CCACATCTGTAAAATGCGGCTGG + Intergenic
1060975673 9:127763648-127763670 TCCCATCTGCAAAATGGGGAGGG + Intronic
1061049335 9:128185404-128185426 CCTCATCTGTAAAATGAGGGGGG - Intronic
1061209481 9:129182529-129182551 ACCCATCTGGAAATTGAGGCTGG - Intergenic
1061806717 9:133141041-133141063 CCCCATCTGTCAAATGGGCAAGG - Intronic
1061847824 9:133397805-133397827 CCTCATCTGTAAAGTGGGGATGG + Intronic
1061894559 9:133640438-133640460 GCCCATCTGTAAAATGGAGATGG + Intronic
1185687271 X:1939596-1939618 CCTCATCTGCAAAGTCAGGCAGG - Intergenic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1186578079 X:10787981-10788003 CCTCATCTGTAAAATGATGATGG - Intronic
1187031630 X:15493713-15493735 CCTCCTCTATAAAATGAGGATGG + Intronic
1187121900 X:16417317-16417339 CCTCACCTGTAAAATGAGAATGG - Intergenic
1187378431 X:18778551-18778573 CCCAATTTGCAAAATGGGGATGG - Intronic
1187650782 X:21403192-21403214 TCACATCTGCAAAATGAGGTGGG - Intronic
1187916093 X:24153345-24153367 CCCCTGCGGCAAAAGGAGGAAGG - Intronic
1188636269 X:32435842-32435864 CCCAATAAGCAAATTGAGGATGG + Intronic
1188928328 X:36073630-36073652 CCTCATCTGTGATATGAGGAAGG + Intronic
1189155083 X:38748770-38748792 CCACATCCACAAAATGAAGATGG + Intergenic
1189346729 X:40247578-40247600 CCCCATCTGTAAAATGGGGATGG + Intergenic
1189546019 X:42043358-42043380 CCTATTCTGAAAAATGAGGATGG - Intergenic
1190115647 X:47624789-47624811 CCTCATCTGCAAAATGAGAATGG + Intronic
1190397306 X:49998162-49998184 CATCATCTGTAAAATGGGGAGGG - Intronic
1190886283 X:54533077-54533099 CCTCATCTGTAAATTGAGAATGG - Intronic
1190983135 X:55475646-55475668 CCTCATCTGTAAGATGAGGATGG + Intergenic
1190985564 X:55497537-55497559 CCTCATCTGTAAGATGAGGATGG - Intergenic
1191043860 X:56114594-56114616 GTCCATATGCAATATGAGGACGG - Intergenic
1191955791 X:66641228-66641250 CTTCATCTACAAAATGAGGATGG - Intergenic
1192099924 X:68253539-68253561 CCCCAACTGTAAAGTGAGGTGGG + Intronic
1192152109 X:68718862-68718884 CCTCATCTGTAAAGTGAGGGAGG + Intronic
1192157936 X:68760283-68760305 CCTCATCTGTAAAATGGGGATGG + Intergenic
1193602437 X:83524271-83524293 CCCCATCTGCAAAATGAGCAAGG - Intergenic
1193843060 X:86433058-86433080 CCTAATCTGTAAAATGGGGATGG + Intronic
1193931491 X:87558285-87558307 TCTCATTTGTAAAATGAGGACGG + Intronic
1195203025 X:102567553-102567575 CCTCATTTGCAAAATGGGGTTGG + Intergenic
1195676689 X:107512182-107512204 CCCCATCTGTGAGATGGGGAGGG + Intergenic
1195767770 X:108314777-108314799 TCCTATCTGTAAAATGAGGATGG + Intronic
1195979017 X:110558644-110558666 CCCCATCTGGAATGTGAGGAGGG - Intergenic
1196401982 X:115326281-115326303 CACCAGCTGTAAAATGAAGAAGG - Intergenic
1196794295 X:119489877-119489899 CCTCATCTGTAAAATGGGGAGGG + Intergenic
1196816430 X:119668649-119668671 CCTCATCTATAAAATGTGGAGGG + Intronic
1197172397 X:123448965-123448987 CCTCCTCTGAAAAATGGGGATGG - Intronic
1198039288 X:132833992-132834014 CTGTATCTGCCAAATGAGGATGG - Intronic
1198399681 X:136256802-136256824 CCTCATCTGTAAAATGAGGATGG - Intergenic
1198439506 X:136648661-136648683 CCACATCTGAGAAATGGGGATGG + Intronic
1198517444 X:137424303-137424325 TCCCATCTGCAAAACCAGGTGGG + Intergenic
1198575843 X:138009484-138009506 CCTCATCTGAAAAATGTGGTGGG + Intergenic
1199513063 X:148644429-148644451 CCTCATCCGCAAAATGAGGATGG + Intronic
1199586370 X:149420625-149420647 CCCAGTCTGGAAAGTGAGGAGGG + Intergenic
1199684597 X:150255017-150255039 CTCCAGCTGAAGAATGAGGATGG + Intergenic
1199709576 X:150459606-150459628 CCTCATCTGTACAATGAGGGTGG + Intronic
1199722850 X:150555015-150555037 CCTCATCTGCAAAAGAGGGATGG + Intergenic