ID: 935130541

View in Genome Browser
Species Human (GRCh38)
Location 2:100257933-100257955
Sequence CCTGGCATCTGGAAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935130541_935130552 5 Left 935130541 2:100257933-100257955 CCCTCCACCTTCCAGATGCCAGG No data
Right 935130552 2:100257961-100257983 CAGGGTCCTGCATTCATGCAGGG No data
935130541_935130551 4 Left 935130541 2:100257933-100257955 CCCTCCACCTTCCAGATGCCAGG No data
Right 935130551 2:100257960-100257982 TCAGGGTCCTGCATTCATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935130541 Original CRISPR CCTGGCATCTGGAAGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr