ID: 935137586

View in Genome Browser
Species Human (GRCh38)
Location 2:100321561-100321583
Sequence CGCCGCACCTGCGGCCGCGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 189}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935137579_935137586 21 Left 935137579 2:100321517-100321539 CCGGGAAGCACTTCTCCAGCAGG 0: 1
1: 3
2: 11
3: 26
4: 234
Right 935137586 2:100321561-100321583 CGCCGCACCTGCGGCCGCGCGGG 0: 1
1: 0
2: 3
3: 13
4: 189
935137582_935137586 -2 Left 935137582 2:100321540-100321562 CCGCTCAGCACCACGTTCACGCG 0: 1
1: 0
2: 0
3: 4
4: 35
Right 935137586 2:100321561-100321583 CGCCGCACCTGCGGCCGCGCGGG 0: 1
1: 0
2: 3
3: 13
4: 189
935137581_935137586 6 Left 935137581 2:100321532-100321554 CCAGCAGGCCGCTCAGCACCACG 0: 1
1: 3
2: 3
3: 22
4: 167
Right 935137586 2:100321561-100321583 CGCCGCACCTGCGGCCGCGCGGG 0: 1
1: 0
2: 3
3: 13
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935137586 Original CRISPR CGCCGCACCTGCGGCCGCGC GGG Exonic