ID: 935137970

View in Genome Browser
Species Human (GRCh38)
Location 2:100323743-100323765
Sequence GAGAACAGAAAGAAGCTTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 420
Summary {0: 1, 1: 0, 2: 4, 3: 25, 4: 390}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935137968_935137970 28 Left 935137968 2:100323692-100323714 CCTTATGATCTCAGATCCTATTT 0: 1
1: 0
2: 1
3: 14
4: 188
Right 935137970 2:100323743-100323765 GAGAACAGAAAGAAGCTTGCCGG 0: 1
1: 0
2: 4
3: 25
4: 390
935137969_935137970 12 Left 935137969 2:100323708-100323730 CCTATTTGTTCTTATTTTAGACA 0: 1
1: 0
2: 5
3: 72
4: 848
Right 935137970 2:100323743-100323765 GAGAACAGAAAGAAGCTTGCCGG 0: 1
1: 0
2: 4
3: 25
4: 390

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935137970 Original CRISPR GAGAACAGAAAGAAGCTTGC CGG Intergenic
900403178 1:2481169-2481191 GAGAACAGGCAGCAGCTGGCAGG - Intronic
904299863 1:29547258-29547280 GAGAAGATAAAGCAGCTTCCAGG + Intergenic
904735578 1:32630045-32630067 GAGTAAAGAAACAGGCTTGCTGG - Intronic
905195217 1:36271077-36271099 CAGAGCAGAAAGAAGCTAACAGG - Intronic
905404995 1:37726618-37726640 CCCAGCAGAAAGAAGCTTGCAGG - Intronic
905544812 1:38789185-38789207 GAGGACACATAGAGGCTTGCTGG - Intergenic
906171001 1:43725178-43725200 GAAAAAAGAAAAAAGCATGCAGG - Intronic
906888509 1:49680343-49680365 GATAAAAGAAAGAATCTGGCTGG - Intronic
907308461 1:53526406-53526428 GACAGCAGTGAGAAGCTTGCCGG + Intronic
907533089 1:55121832-55121854 GATAACAGATAAAAGCTTGGAGG + Intronic
907537786 1:55180618-55180640 GAGAACAGAAAGATGAGTTCAGG - Intronic
908482093 1:64551245-64551267 GAGAACTGAAAGAAGATGGGAGG - Intronic
908573161 1:65430773-65430795 GAACACAGAAACTAGCTTGCTGG + Intronic
908635738 1:66162488-66162510 TGGAACAGAGAGAAGCTGGCTGG - Intronic
908871143 1:68614226-68614248 GACACCAGAAATAAGCATGCTGG + Intergenic
908941107 1:69435353-69435375 GAGAACAGAAATAAGTGTGCAGG - Intergenic
909067227 1:70949861-70949883 GAAAATAGAGAGAGGCTTGCTGG + Intronic
909630381 1:77764289-77764311 AAGAACAGAAAGGATCTTTCTGG + Intergenic
911031978 1:93498731-93498753 GAGAACTGAAAGAGCCTTGTAGG + Intronic
912512984 1:110201076-110201098 GGGAACAGCAAGAAGCTGACTGG - Exonic
912718083 1:111996216-111996238 GAGGACAGAAAGAAGAATGAGGG + Intergenic
913303458 1:117398375-117398397 AAGAACTGAAAGAAGGTGGCTGG + Intronic
914193827 1:145433538-145433560 GAGAGCAGAAAGAAAGTTGATGG + Intergenic
914475156 1:148016412-148016434 GAGAGCAGAAAGAAAGTTGATGG + Intergenic
916930692 1:169575537-169575559 GAGAACAGATAGAAGACTCCAGG + Intronic
917241069 1:172949349-172949371 GAGAACAAAACGAAGCTAACTGG - Intergenic
918083752 1:181227796-181227818 GAGAAGAGAAGGAAGGATGCTGG - Intergenic
919205035 1:194411048-194411070 GAGAACTGAAATAAGCATTCTGG + Intergenic
919299805 1:195745720-195745742 AAGAAAAAAAATAAGCTTGCTGG + Intergenic
920170230 1:204067423-204067445 GAGAACAGGAAGAAGCATACTGG - Intergenic
920539760 1:206769495-206769517 AAGTACAGAAAGTAGCTTGTTGG - Intronic
922419238 1:225448434-225448456 GGGATCAGAGAGAAGTTTGCAGG + Intergenic
922933656 1:229408400-229408422 GGGAACAGAAAGAAGCCATCAGG + Intergenic
922951862 1:229564685-229564707 GACTACACAAAGAACCTTGCAGG + Intergenic
923859446 1:237878324-237878346 GAGAACCTAAGGAAGCTGGCAGG - Exonic
924014131 1:239701403-239701425 AAGAAGAGAAAGAAGCATGGAGG - Intronic
924264360 1:242266818-242266840 TAGAAAAGAGAGAAGCTGGCCGG + Intronic
924623208 1:245680016-245680038 GAAAAGAGGAAGAAGCGTGCAGG - Intronic
1063402877 10:5764506-5764528 GGGAAGAGAAAAAGGCTTGCTGG + Intergenic
1063494140 10:6491249-6491271 GATGACAGAAAGAATCTTACTGG + Intronic
1065193687 10:23239661-23239683 GAGAACAGAAAGAAACAGACAGG + Intronic
1065912527 10:30321478-30321500 GAGAAGAGAAAGCAGATTCCAGG + Intronic
1066433968 10:35379671-35379693 GAGAACAAAGCGAAGCTTGTGGG + Intronic
1066932914 10:41788447-41788469 GAAACTAGAAAGAAGCTTTCTGG + Intergenic
1066934437 10:41808827-41808849 GAAATCAGAAAGAAGCTTTCTGG - Intergenic
1068570995 10:58629066-58629088 GAGAGAAGAAAAAAGCATGCAGG - Intronic
1069690754 10:70350267-70350289 GGGAACAGAAAGATCCTTGGGGG + Intronic
1072703577 10:97663375-97663397 GAGAAAGGAAAGAAAGTTGCAGG - Intronic
1073059615 10:100725584-100725606 GAGAAAAGAAAGACCATTGCAGG + Intergenic
1073586701 10:104717378-104717400 GAGAACAGAAGGAAACCTGAAGG - Intronic
1075798471 10:125137197-125137219 GACAACAGGAAGAAGGATGCAGG + Intronic
1076200028 10:128550822-128550844 GAGATCAGAAAGACACGTGCAGG - Intergenic
1076733609 10:132449516-132449538 GAGAACAGACAGAACCTTCCAGG - Intergenic
1077110414 11:859741-859763 GAGACCAGGAAGAGGCTTGGGGG - Intronic
1077764482 11:5143830-5143852 GAGACTAGAAAGAATCTTGAAGG - Intergenic
1078162452 11:8853381-8853403 AAGAAAAGAAAGACGCTTGAGGG + Intronic
1078855318 11:15201847-15201869 GAGGACAGAGAGCAGTTTGCTGG - Intronic
1079050997 11:17159380-17159402 GAACAAAGAAAGAAGTTTGCAGG + Intronic
1080367612 11:31594241-31594263 AAGAAGAGACATAAGCTTGCAGG + Intronic
1080450941 11:32378411-32378433 GAGAAAGGGAAGAAGCTTCCAGG - Intergenic
1081239281 11:40683093-40683115 GAGAAGAGAAAGAACATAGCTGG - Intronic
1081806429 11:45893404-45893426 GAGAACAGTGAGGAGCTGGCAGG + Intronic
1082883709 11:58062647-58062669 GAGAACTCAAAGCAGCCTGCAGG + Intronic
1084737023 11:71112095-71112117 GAGCACAGTAAGAATCCTGCCGG + Intronic
1084754566 11:71228455-71228477 GAGCACAAAAAGAAGATTACAGG + Intronic
1085396218 11:76208473-76208495 GAGAAGTGCAAGAAACTTGCAGG - Intronic
1085825171 11:79839755-79839777 AAGAACAGGAAAAAGCTTGAGGG - Intergenic
1085951430 11:81337127-81337149 TACAACAGAAAGAATCTTGGAGG + Intergenic
1087027477 11:93663950-93663972 GATGGCACAAAGAAGCTTGCTGG - Intronic
1088734100 11:112712026-112712048 GAAAAGAGCAAGAAGTTTGCTGG + Intergenic
1088994394 11:114983963-114983985 GAGAACAGAAATATGGTTGAGGG - Intergenic
1089553210 11:119297907-119297929 GAGAAAAAAAAGGAGCTTACAGG - Intronic
1089563332 11:119356973-119356995 GGGCACAGAAAGAAGCCGGCGGG - Intronic
1090616271 11:128518198-128518220 GAGAACAGAATGAAGTTTCACGG + Intronic
1091737966 12:2938892-2938914 TAGAATAGAGAGCAGCTTGCTGG - Intronic
1092132394 12:6121632-6121654 AAGAAAACAAAGAAGCTGGCCGG + Intronic
1094140212 12:27172994-27173016 AAGAACAAAAAGAAGGTTGAAGG - Intergenic
1095071043 12:37847555-37847577 AAGACTAGAAAGAAGCTTTCTGG - Intergenic
1095758181 12:45794957-45794979 GAAAAAAGAAAGAAACTTGTGGG - Intronic
1095859859 12:46905011-46905033 GACGACTGAAAGAAGCTTGGTGG - Intergenic
1096306164 12:50479078-50479100 AAGAACAAAAAGAATGTTGCTGG + Exonic
1096404660 12:51334765-51334787 GAGGAGAGAGAGAAGCTGGCAGG - Intronic
1096729106 12:53592323-53592345 GAGAAAAGATAGAAGCTTTGAGG - Intronic
1097193329 12:57230678-57230700 GAGAACTGAAACAGGCTGGCTGG + Intronic
1097392753 12:59035491-59035513 GGGAAAAGCAAGAAGCTTGTTGG + Intergenic
1097422801 12:59401562-59401584 GTAAACAGAAAGAAGGTTTCAGG + Intergenic
1097688572 12:62713375-62713397 GAGAGCTGAAAGAAGGCTGCTGG + Intronic
1098837457 12:75439775-75439797 GAGAGCTGAAAGAAGATTACTGG + Intergenic
1099893791 12:88620205-88620227 GAGGAGACAAAGAAACTTGCAGG + Intergenic
1101319581 12:103661777-103661799 CAGAGCAGAAAGGAGCATGCTGG + Intronic
1102024663 12:109707432-109707454 GAGGACAGAGAGAACCTTGGAGG + Intergenic
1102814915 12:115858038-115858060 GAGAACAGGGAGAAAGTTGCTGG - Intergenic
1103166836 12:118777571-118777593 GAGAAAAGAAAGCAGTTTACTGG + Intergenic
1104102128 12:125622709-125622731 GAGAGCAGAAAAAAGGTTTCTGG - Intronic
1104287327 12:127435807-127435829 GAAAACAGGAACAAGCTTGAAGG - Intergenic
1106311977 13:28562756-28562778 GGGGACAGAAAGAAGCTGGATGG - Intergenic
1108227221 13:48302599-48302621 GACATCAGAAAAGAGCTTGCTGG - Intergenic
1108411801 13:50156435-50156457 ATGAAAACAAAGAAGCTTGCTGG - Intronic
1108469853 13:50756728-50756750 GAACCCAGAAAGAAGCTTCCTGG - Intronic
1108730995 13:53235687-53235709 GAGACAAGAAAGAAGGATGCTGG - Intergenic
1109081512 13:57907864-57907886 GAGAAGAGAAATAAGCCTGTGGG - Intergenic
1109334220 13:60971780-60971802 GAGAACAGAAGGAAGGGTGGGGG - Intergenic
1109523386 13:63542990-63543012 GAAAGCAGAAAGAAGCCAGCAGG - Intergenic
1109833027 13:67817689-67817711 AAGAAGAGAAAGAAGTTTGGTGG - Intergenic
1110139921 13:72115846-72115868 GTGTATAGAAAGAAGCTGGCTGG - Intergenic
1110184334 13:72655894-72655916 GAGAACAGAAGGAAGAATGTAGG + Intergenic
1110717813 13:78727813-78727835 GAAAATAGGAAGAAGCTTACAGG - Intergenic
1110828158 13:79997446-79997468 GAGCAGAGGAAGTAGCTTGCTGG + Intergenic
1110983085 13:81927934-81927956 GCAAACAGAAAAAGGCTTGCTGG - Intergenic
1111249995 13:85589963-85589985 AAAAATAGAAAGAAACTTGCTGG - Intergenic
1111386616 13:87536743-87536765 GAGAAAAGATAGAAGCATGGGGG + Intergenic
1111982478 13:95031423-95031445 GAGAACAGAAGGTAGATTGCTGG - Intronic
1112347321 13:98601116-98601138 GAGTCCAGAAAGAATCCTGCTGG - Intergenic
1113129202 13:107016312-107016334 TAGAACTGAAAGAAGCTGCCCGG + Intergenic
1114174092 14:20303609-20303631 GAGAACAGAAACAAGATGACTGG - Intronic
1114445490 14:22784785-22784807 CAGAACAGAACAAAGCTTGCAGG + Intronic
1114869338 14:26637009-26637031 CGAAGCAGAAAGAAGCTTGCCGG + Intergenic
1117461489 14:55949562-55949584 CAGAACAGAAAGAAAAATGCTGG - Intergenic
1119224567 14:72934871-72934893 CAGAGCAGAAAGAAGCTACCTGG + Intronic
1119403369 14:74379298-74379320 GAGAACAGAAAAAAAGTGGCCGG + Intergenic
1119635470 14:76269768-76269790 GAGAAGAGAAACAAGCTAGATGG + Intergenic
1120974491 14:90236625-90236647 GGGAACAGAAAGTAGGTTGGTGG - Intergenic
1122037250 14:98957716-98957738 GTGGACAGGAAGAAGCTGGCCGG + Intergenic
1122170754 14:99872732-99872754 GAAAACAGAAAGAAGCAGGCTGG + Intronic
1122468603 14:101950774-101950796 GAGAACAGCAAGAAAGCTGCTGG - Intergenic
1123415700 15:20093470-20093492 GAGGACAGACAGAAGTCTGCAGG + Intergenic
1123525039 15:21100584-21100606 GAGGACAGACAGAAGTCTGCAGG + Intergenic
1123956612 15:25342537-25342559 GAAAACACGAAGAAGCTTCCAGG + Intronic
1124855336 15:33382126-33382148 GGGAACTGCAAGAAGCTTGGTGG + Intronic
1126288306 15:47042094-47042116 GAAAATAGAATGAAGGTTGCTGG - Intergenic
1127413766 15:58735813-58735835 GAGAACAGATACCAACTTGCTGG - Intronic
1127576940 15:60300969-60300991 AAGAAGAGAAAGAGGATTGCAGG - Intergenic
1127617388 15:60700730-60700752 AGGAACAGAAAAAAGCTTGGAGG - Intronic
1127939626 15:63681850-63681872 GAGAACAGAAGGAAGCCTACAGG + Intronic
1128063337 15:64748787-64748809 GAGAAATTAAAGAAGGTTGCAGG + Intronic
1129115265 15:73362074-73362096 GTGAACAGGAAGAAGCTGGGTGG - Intronic
1131621852 15:94076692-94076714 AAGAACAAAAAGAATGTTGCTGG + Intergenic
1133089965 16:3396461-3396483 CAGAGCAGGAAGCAGCTTGCTGG - Intronic
1133352683 16:5112546-5112568 AAAAACAAAAAGAAGCTAGCCGG - Intergenic
1133554907 16:6896820-6896842 TAGGATAGAAAGAAGATTGCAGG + Intronic
1133739985 16:8644110-8644132 GAGAACAGAGAGAAAACTGCTGG - Intronic
1135550904 16:23397529-23397551 GAGAACAGAATAAACCATGCAGG - Intronic
1135554028 16:23420497-23420519 GTGAACAGAAGGAAGCTTTTAGG - Intronic
1135777646 16:25270970-25270992 AAGAAAAGGAAGAAGCTAGCAGG - Intergenic
1136480261 16:30537045-30537067 AAGAAAAGACAGTAGCTTGCTGG - Intronic
1138063068 16:53911653-53911675 GAGAACAGAGTAAAGCTAGCTGG - Intronic
1138085404 16:54129189-54129211 TAGGACAGAAAGAAGACTGCTGG + Intergenic
1138367554 16:56493542-56493564 GAGAACAGAATGAAGGTCACAGG + Intronic
1139708392 16:68758111-68758133 AAAAAAAGAAAGAAACTTGCAGG - Intronic
1140826213 16:78709322-78709344 GATCACAGAGAGAAGCTTGTTGG + Intronic
1142401217 16:89859774-89859796 GAGCACAGAACGATTCTTGCTGG + Intronic
1203012163 16_KI270728v1_random:305198-305220 GAAAACAGAAGGAAGCTATCTGG + Intergenic
1203030498 16_KI270728v1_random:578357-578379 GAAAACAGAAGGAAGCTATCTGG + Intergenic
1203041223 16_KI270728v1_random:756074-756096 GAAAACAGAAGGAAGCTATCTGG - Intergenic
1143502149 17:7345622-7345644 AAGAAAAGAAAGAATCTTGGGGG - Intronic
1144352449 17:14410535-14410557 GAGAATTTAAAGAAGCTTGCTGG + Intergenic
1144796677 17:17896165-17896187 GAGAACAGAAAGAACCCCTCTGG - Intronic
1144953700 17:19007953-19007975 GAGAACACAAAGAAGGTTAGAGG + Intronic
1145106567 17:20122657-20122679 AAGAACAGAATGGTGCTTGCCGG - Intronic
1146583112 17:34057600-34057622 TACAACAGAAAGAAAATTGCAGG + Intronic
1146618132 17:34372966-34372988 CAGATTAGAAGGAAGCTTGCAGG - Intergenic
1148286887 17:46401478-46401500 TATAAAAGAAAGAAGCTTGCAGG + Intergenic
1148309056 17:46619068-46619090 TATAAAAGAAAGAAGCTTGCAGG + Intronic
1149320953 17:55480105-55480127 TAGAACAGAAAGAAGTTGGTTGG + Intergenic
1150238383 17:63611584-63611606 GTGAACAGAAAGAAGAGTGAGGG + Intergenic
1150508219 17:65720636-65720658 GAGTACAGACAGAAGCTAGAAGG + Intronic
1150525145 17:65915170-65915192 GAGAAGAGAAAGGAACTTCCAGG - Intronic
1150637830 17:66928502-66928524 GAAAACAGAAAGGATCTTTCTGG - Intergenic
1151197651 17:72443243-72443265 GAGGACAGTATGAATCTTGCAGG - Intergenic
1151236907 17:72727349-72727371 CAGAACAGAAAGAAGCAAGCTGG + Intronic
1151484693 17:74391367-74391389 GACAAGAGAAAGGAGCTTTCAGG + Intergenic
1152561082 17:81079115-81079137 GAGGACAGAAAGATGCTGGCCGG + Intronic
1153609792 18:6872079-6872101 GGGAAAAGAGAGAAGCCTGCAGG + Intronic
1153776074 18:8455266-8455288 GAGAAGAGGGAGAAGCTTCCTGG - Intergenic
1154331105 18:13429667-13429689 GAGAACGCAAAGAGGCTTTCAGG + Intronic
1155775981 18:29762130-29762152 GAGAAGAGAAAGAAGCAGGGAGG - Intergenic
1155843899 18:30681721-30681743 AAGAAGAGAAAGAAGCTGGATGG - Intergenic
1155939174 18:31786451-31786473 AAGAACAGATAGCAGCTGGCTGG - Intergenic
1155979295 18:32164008-32164030 ATTAACAGAGAGAAGCTTGCAGG + Intronic
1156369762 18:36462264-36462286 GAGAACTGAAGGAAGGTAGCTGG - Intronic
1160042821 18:75360934-75360956 GAGAACAGAAGGAGTCCTGCCGG - Intergenic
1160482741 18:79257510-79257532 TGGAACAGAGAGAACCTTGCAGG + Intronic
1160497614 18:79384364-79384386 GAGAACAGAAAGCAGAGAGCTGG + Intergenic
1160721803 19:600775-600797 GATAAAAGAAAAAAGCCTGCTGG - Intronic
1161362077 19:3856034-3856056 GAGAGCAGAAGGAAGCGTGAAGG + Intronic
1162117350 19:8438887-8438909 GAGAAGCGCAAGAAGCTTGCTGG - Exonic
1162693308 19:12451280-12451302 GACGACTGAAAGAAGCTTGGTGG + Intronic
1163386714 19:17004505-17004527 GAGACCACAGAGAAGCTGGCGGG + Intronic
1163845658 19:19636997-19637019 GACATCAGAAAGAAGCTCTCTGG - Exonic
1164147481 19:22520852-22520874 AGGAACAGAAGGAAGATTGCTGG - Intronic
1164328469 19:24226372-24226394 GAAACTAGAAAGAAGCTTTCTGG - Intergenic
1164362444 19:27529315-27529337 AAAAATAGAAAGAAGCTTTCTGG + Intergenic
1164363054 19:27539684-27539706 GAAACTAGAAAGAAGCTTTCTGG + Intergenic
1164368085 19:27609727-27609749 AAAAATAGAAAGAAGCTTTCTGG + Intergenic
1164752956 19:30669664-30669686 AAAACCTGAAAGAAGCTTGCAGG + Intronic
1164896332 19:31880572-31880594 GTGAGCTGAAAGACGCTTGCAGG + Intergenic
1168573865 19:57492011-57492033 TAGTACAGAAAGAACCTTGGAGG - Intronic
1168575477 19:57505200-57505222 TAGTACAGAAAGAACCTTGGAGG - Intronic
924962726 2:47788-47810 GAGAAGAGAAGGAAGGATGCGGG + Intergenic
925322559 2:2986100-2986122 GAAAACAGACAGTAGCTTGATGG - Intergenic
925651652 2:6096624-6096646 AAGAAAGGAAAGGAGCTTGCAGG + Intergenic
926632703 2:15151490-15151512 GAGAATTTAAAGAAGTTTGCTGG - Intergenic
928350282 2:30546107-30546129 GAGATCAGAGAGAAGCCAGCAGG + Intronic
929288374 2:40162243-40162265 GAGAAAAGAAAGATGGATGCTGG - Intronic
929494263 2:42425534-42425556 GAGAACTGAAAGCGGCTGGCAGG + Intergenic
929589327 2:43134760-43134782 GAGAGCAGAGAGAAGCTTGAGGG - Intergenic
931648354 2:64445877-64445899 GAGAACACAAAGCAGCTGTCTGG - Intergenic
932032644 2:68206143-68206165 AAGAACAGAGAGAAACTTCCAGG + Intronic
932706070 2:74026081-74026103 GAGAGCAGAAGGCAGCTTCCTGG - Intronic
933976772 2:87518417-87518439 GATAACAGACAGAAGGCTGCTGG - Intergenic
934367742 2:92690794-92690816 AACAACACAAAGAAGTTTGCTGG - Intergenic
935057126 2:99577326-99577348 GAGCACAGAAAGCACCATGCAGG - Intronic
935137970 2:100323743-100323765 GAGAACAGAAAGAAGCTTGCCGG + Intergenic
935940550 2:108233541-108233563 GAGAGCAGAATGATGTTTGCCGG + Intergenic
936062630 2:109305478-109305500 GAGACCAGAAGGAAACTAGCAGG - Intronic
936317043 2:111432387-111432409 GATAACAGACAGAAGGCTGCTGG + Intergenic
936937280 2:117850478-117850500 GTGAAAAGAAAGCAGCTGGCAGG + Intergenic
937004610 2:118500169-118500191 GACAACTGAAACATGCTTGCTGG + Intergenic
937085077 2:119166232-119166254 CAGGACAGAAAAAAGCTGGCAGG - Intergenic
937321869 2:120965803-120965825 GAGGACAGAAAGAAGCAGGGAGG - Intronic
937503852 2:122514212-122514234 AAAAACAGCAAGAAGCTTCCTGG + Intergenic
938077581 2:128347965-128347987 GAGCAGAGAAAGAAGACTGCAGG - Intergenic
938751735 2:134337815-134337837 GTGGACAGAAAGAGGCTTTCTGG + Intronic
939538080 2:143458091-143458113 GAGAACATAAAGAAACTAGAAGG + Intronic
939735351 2:145837311-145837333 GGGGACAGAAAGAAGGTTTCAGG + Intergenic
940047816 2:149428450-149428472 AAGAAGAGAATGAAACTTGCTGG - Intronic
940427022 2:153541705-153541727 GAAAACAGGAAGAATCTAGCTGG + Intergenic
941515460 2:166469884-166469906 TAGACCAGAAAGAAGCCTGTAGG + Intronic
941523383 2:166577101-166577123 GAGAATAGAAAGTAGATTGGTGG - Intergenic
941582080 2:167310771-167310793 AAGAAAAAAAAGAAGCCTGCTGG + Intergenic
944019309 2:195082248-195082270 GAGAACAGAAAGAAGTGAACAGG - Intergenic
944300399 2:198117872-198117894 GAGAACAGGAAGGAAGTTGCTGG - Intronic
945539334 2:211064896-211064918 GAGAACAAAAAGAATATGGCAGG - Intergenic
946008859 2:216548775-216548797 GAGAACAGAAAGAACTTCTCAGG - Intronic
946709793 2:222494082-222494104 GAGAACAAAAAGCAGTTTGGTGG - Intronic
947223416 2:227817122-227817144 AAGAACAGAAAGAACCTTGCTGG + Exonic
947295519 2:228626427-228626449 GGGCACAGAAAGAAGAGTGCAGG + Intergenic
947303100 2:228711001-228711023 GAGAACTGAAACAAACTTGTAGG - Intergenic
948401100 2:237686100-237686122 CAGAACAGAAAGGAGCCTGAAGG - Intronic
948677581 2:239607835-239607857 GAGGACAGGGAGAAGGTTGCTGG + Intergenic
1169315369 20:4586005-4586027 GAGAAGAGAAGGAAGCTGGCTGG + Intergenic
1170329517 20:15193123-15193145 GAGAAGAGAAAGAAGATGGGAGG - Intronic
1170403976 20:16017132-16017154 GAAAACAAAAAGAAACTTGGAGG - Intronic
1171945271 20:31371085-31371107 GAGATCACATAGAATCTTGCAGG - Intronic
1172411317 20:34725541-34725563 GAGACCACACAGAAGCTTGTGGG + Intronic
1172815828 20:37685185-37685207 GGGAACAGAAAGAATCTTTGAGG + Intergenic
1172953854 20:38741143-38741165 GAGAACCAAAAGAAGGTTTCGGG - Intergenic
1173030634 20:39356363-39356385 GAGAACACAAAGAAGCTTCAGGG + Intergenic
1173422550 20:42915376-42915398 CAGATCAGAAGGCAGCTTGCTGG - Intronic
1174580147 20:51565658-51565680 GAGAAAGGAAACAAGCTTGCTGG + Intergenic
1175307863 20:57989869-57989891 GAGGAGAGAAAGAAGGTGGCTGG + Intergenic
1175468553 20:59209433-59209455 GAGAACAGACAGAGACTTTCTGG + Intronic
1175755750 20:61528625-61528647 GAGAAGAGAAAGAAGTTAGATGG + Intronic
1176185208 20:63774650-63774672 GAGACCAGAAGGCAGCTGGCTGG + Intronic
1176849883 21:13904765-13904787 GAGAGAAGTAAGAAGCTTTCTGG - Intergenic
1177328927 21:19630550-19630572 GAAAACAGAAAGTAACTGGCAGG + Intergenic
1177717937 21:24864880-24864902 GAAAATAGAAAGAAGCATGAGGG + Intergenic
1178764217 21:35433933-35433955 AAGAACAGAATGAAGCTGGTTGG - Intronic
1179673053 21:42963128-42963150 GAGGATAGAAAGAAGCTTGCGGG - Intergenic
1180763405 22:18226187-18226209 GAGAACAGAATGGTGGTTGCTGG + Intergenic
1180772240 22:18398357-18398379 GAGAACAGAATGGTGGTTGCTGG - Intergenic
1180803619 22:18647973-18647995 GAGAACAGAATGGTGGTTGCTGG - Intergenic
1180807146 22:18721474-18721496 GAGAACAGAATGGTGGTTGCTGG + Intergenic
1181082310 22:20423769-20423791 GAGAACAAGAAGAGGCCTGCCGG + Intergenic
1181218100 22:21347291-21347313 GAGAACAGAATGGTGGTTGCTGG + Intergenic
1181862622 22:25830647-25830669 GAGAGCAAACAGAAGCGTGCAGG + Intronic
1182544386 22:31066009-31066031 GAGGACAGACAGAAGTCTGCAGG - Intronic
1182710479 22:32319654-32319676 GAGAAGAGACAGGAGCATGCTGG - Intergenic
1182802439 22:33042469-33042491 TAAATCAGAAAGAATCTTGCTGG + Intronic
1203234079 22_KI270731v1_random:139346-139368 GAGAACAGAATGGTGGTTGCTGG - Intergenic
950329092 3:12141994-12142016 GAGGACAGAAAGACCCTTACCGG - Exonic
950912483 3:16609114-16609136 GAGAAAAGAAGTAACCTTGCAGG + Intronic
951327934 3:21327485-21327507 GAGAACAGAAAAAAGAGTGATGG - Intergenic
951491017 3:23270508-23270530 GAGAACAGAACGAGCCCTGCAGG - Intronic
951731791 3:25817671-25817693 GCCAGCACAAAGAAGCTTGCTGG - Intergenic
953167839 3:40481487-40481509 AAGACCAGAAAGAAGCTGGGTGG + Intronic
954041434 3:47890831-47890853 GAGAACAAAGTGAATCTTGCAGG - Intronic
955798014 3:62658025-62658047 GAGAAAAGAAAGCAGTTTCCAGG + Intronic
959349221 3:105239492-105239514 GAGAAAATAAAGAAGCTATCAGG - Intergenic
961243003 3:125428662-125428684 TAGGACAGCCAGAAGCTTGCTGG - Intergenic
963267885 3:143257037-143257059 GAGAACAGAATGGAGATTTCTGG - Intergenic
963752659 3:149199000-149199022 TAGAACTGAAAGAACTTTGCAGG + Intronic
964092803 3:152895858-152895880 GAGAAGAGAAAGGTGCTAGCTGG + Intergenic
964166888 3:153718681-153718703 GATAAGAGAAATTAGCTTGCTGG - Intergenic
965370915 3:167861672-167861694 GGGAGCAGAGAGAAACTTGCAGG - Intergenic
965611456 3:170548251-170548273 GAGAATTGAAAGAACCTTGAAGG - Intronic
966661895 3:182424111-182424133 AAGAAAAGAAAAAAGCTTGCAGG - Intergenic
967832467 3:193932113-193932135 GAGAACAGGAAGAATTTTGTTGG - Intergenic
967839290 3:193991910-193991932 GAAAACAGGAAGAAGCTTCTTGG - Intergenic
968055530 3:195688776-195688798 AGGCACAGGAAGAAGCTTGCAGG + Intergenic
968100263 3:195959821-195959843 AGGCACAGGAAGAAGCTTGCAGG - Intergenic
970366839 4:15368021-15368043 AAGGACAGAAAGAAACTTTCAGG - Intronic
971425073 4:26507929-26507951 GAGGACAGACAGATGGTTGCAGG - Intergenic
971566781 4:28154359-28154381 GAGAACAGAATGGAGGTTGGTGG - Intergenic
971663203 4:29447147-29447169 GGGAACAGAAACAAGATTGTTGG + Intergenic
973333506 4:48933395-48933417 GTGAACAAATCGAAGCTTGCTGG - Intergenic
974112510 4:57542085-57542107 GAGAATAGAGACCAGCTTGCTGG - Intergenic
977177164 4:93831454-93831476 GATAACAGAAAAAAACTTGAGGG + Intergenic
977986684 4:103390660-103390682 AAGAACACAAACAAGCTTACAGG + Intergenic
978392017 4:108236848-108236870 GAGGCCAGAAAGAAGCCTACTGG + Intergenic
978431567 4:108638629-108638651 GAGAGCAGAAAGAAGATTAGAGG - Intergenic
979389951 4:120116971-120116993 TAGAAAAGAAAGAGGCTTGTTGG + Intergenic
980735756 4:136885154-136885176 TAGGAAAGAAAGAAGCTTGCAGG - Intergenic
981430995 4:144659926-144659948 AATAAAAGAAAGAATCTTGCAGG + Intronic
983071595 4:163274219-163274241 GAGAATAGTATGTAGCTTGCAGG + Intergenic
985720997 5:1489022-1489044 CAGAACTGAAAGCAGCCTGCGGG - Intronic
986967972 5:13298504-13298526 GAGAGTAGAAAGATGCTTACTGG + Intergenic
987783772 5:22471977-22471999 GAGAACAGTAAGAAGGTCACTGG + Intronic
990000524 5:50886392-50886414 GGTAACAGAAAGAAGCTGTCTGG + Intergenic
990253689 5:53943071-53943093 GAGCCAAGAAAGAAACTTGCTGG + Intronic
992003669 5:72458310-72458332 GAGAGAAGAAAGATGCTGGCCGG - Intronic
992754252 5:79889272-79889294 GAGAAGAGATAGAAGCAGGCTGG + Intergenic
994139216 5:96323193-96323215 CAGAACAGACAGCTGCTTGCTGG - Intergenic
994838252 5:104885812-104885834 GAAAACAGAAAGATGATTGTTGG - Intergenic
995569449 5:113463953-113463975 GAGAACAGCAAGAAGACTGTGGG + Intronic
995827306 5:116314921-116314943 GCCAACAGAAAGAAGCTACCTGG - Intronic
997233779 5:132261022-132261044 ATGAAGAGAAAGAAGCTTGGGGG - Intronic
999576074 5:152978815-152978837 GAGAGAAGAAAGAAGCTTGAAGG + Intergenic
999721932 5:154405041-154405063 GAGGATAGAAAGAGCCTTGCGGG + Intronic
1000021300 5:157321645-157321667 GAGAACAGAGAGAGGCTTAAAGG - Intronic
1000030915 5:157400632-157400654 ATGAACAGAAAAAAGATTGCAGG + Intronic
1000672992 5:164085597-164085619 GAAAAGAGAGAGAAGCTTGTGGG + Intergenic
1000713906 5:164616041-164616063 AAGAAGAGAAAGAAACTAGCAGG + Intergenic
1001264571 5:170264198-170264220 AAGAACAAAAAGAAGATTGGAGG - Intronic
1001325878 5:170723556-170723578 GCTTACAGAGAGAAGCTTGCCGG - Intronic
1003965982 6:11252564-11252586 GAGAGCAGAAAGGAGCTGGTAGG + Intronic
1004019436 6:11763415-11763437 GAGAAATGAAAGAAGCTTTCAGG + Intronic
1004886780 6:20058913-20058935 TAGAACAGAAAGAAATTTGACGG - Intergenic
1005318459 6:24627736-24627758 GAAACCAGTAAGAAGATTGCTGG - Intronic
1005530794 6:26703333-26703355 GTGAAGAGAAACAATCTTGCTGG + Intergenic
1005720573 6:28597730-28597752 GAGAACACAGAGGAGCTAGCTGG - Intronic
1008216234 6:48793069-48793091 GAAAACAAAAAGTAGCTGGCCGG - Intergenic
1008640323 6:53455733-53455755 GTGAACAGAAAGCAGATTGATGG - Intergenic
1009064348 6:58439731-58439753 AATACCAGAAAGAAGCTTTCTGG + Intergenic
1009489665 6:64273957-64273979 GAGAACAGAAAGGAGTCTGGAGG - Intronic
1011301750 6:85882560-85882582 GAAAACAAAAACAAGCTTTCAGG - Intergenic
1012833557 6:104236907-104236929 GAGAAGAGGAGGAAACTTGCTGG - Intergenic
1013129440 6:107218088-107218110 AAGAACAGAGAGAAGGTTGGAGG - Intronic
1015385787 6:132621559-132621581 AGGAACACAAAGAAGTTTGCAGG - Intronic
1017139632 6:151178917-151178939 GAGACCAGGAAAAAGCTCGCGGG + Intergenic
1018288483 6:162265701-162265723 GTGAACAGGTAGAAGCTTTCTGG - Intronic
1018359728 6:163055010-163055032 GAGAACAGAAAGGAGATTCAAGG + Intronic
1018977729 6:168578191-168578213 GAGAAGGGACAGAAGATTGCAGG - Intronic
1020773336 7:12423362-12423384 GAGGACACAAAGAACATTGCTGG - Intergenic
1020971245 7:14942635-14942657 GGGAACAGAAAGAAGTGAGCCGG - Intronic
1022606824 7:31823684-31823706 GGGATCAGAAAGACCCTTGCAGG - Intronic
1023612656 7:41986928-41986950 GAGAATAGGAAGAAGGTTGAAGG + Intronic
1025186860 7:56867363-56867385 GAGAACAGCAAACAGCTAGCAGG + Intergenic
1025580911 7:62715654-62715676 AAAACCAGAAAGAAGCTTTCTGG + Intergenic
1025588662 7:62826579-62826601 AAAAAAAGAAAGAAGCTTTCTGG + Intergenic
1025590066 7:62847545-62847567 AAAAAGAGAAAGAAGCTTACTGG + Intergenic
1025602405 7:63012945-63012967 GAAAACAGGACCAAGCTTGCAGG - Intergenic
1025685062 7:63709549-63709571 GAGAACAGCAAACAGCTAGCAGG - Intergenic
1026295079 7:69044421-69044443 GACAACAGAAAGAAGATTAATGG + Intergenic
1026302796 7:69112454-69112476 GAGAACAGAAAGAGAATTACTGG + Intergenic
1026615365 7:71897819-71897841 GAGAACAGAAACAGACTTGGAGG + Intronic
1027185094 7:75966334-75966356 GAAAACAGAAAGTGGTTTGCTGG - Intronic
1028571877 7:92298053-92298075 GAGAACAGAAAGAATACTGGAGG - Intronic
1028683074 7:93560805-93560827 GATAACCAAAAGAAGCTTGGGGG + Intronic
1029348264 7:99994273-99994295 TAGAACAGAATGCAGCTTTCAGG + Intergenic
1029557418 7:101279957-101279979 GAAAACAGGACCAAGCTTGCAGG - Intergenic
1029585828 7:101470436-101470458 GAAGAAAGACAGAAGCTTGCAGG - Intronic
1030841895 7:114364311-114364333 CATAACAAAGAGAAGCTTGCTGG - Intronic
1030967857 7:116016266-116016288 AAGAACAGAAATCAGCCTGCAGG + Intronic
1032195190 7:129784674-129784696 GAGAGGAGAGAGAAGCGTGCGGG + Intergenic
1032632793 7:133671848-133671870 GACTACAGGAAGAAGCTAGCTGG + Intronic
1033202783 7:139388015-139388037 GAGAGGAGAAAGAATATTGCAGG - Intronic
1037016771 8:13917454-13917476 CTGAACACAAAGAAGTTTGCAGG - Intergenic
1037563117 8:20092539-20092561 GAGAACAAGAGGGAGCTTGCTGG - Intergenic
1038515886 8:28187411-28187433 GAGAACAGAATGAAGGCTCCAGG - Intronic
1040794787 8:51277310-51277332 GAGAATATAAAAAAGCTTTCAGG + Intergenic
1041610936 8:59848061-59848083 AAAAACAGAAAGAAGCTTATAGG + Intergenic
1042744781 8:72096118-72096140 GAGCACAGAAAGGAGCAAGCAGG + Intronic
1042796006 8:72664140-72664162 GAGATCAGAATGAGGCTTACCGG + Intronic
1043834973 8:85035512-85035534 GAGATCAGAAATAAGCATACTGG + Intergenic
1044100137 8:88124898-88124920 GAGAGAAAAAGGAAGCTTGCTGG + Intronic
1044297803 8:90548663-90548685 GAGAATAGAAGGATGGTTGCTGG + Intergenic
1045445385 8:102256969-102256991 GAGTACAGAAAGGATCTTCCAGG + Intronic
1047600938 8:126425398-126425420 AAGAACAGAAAGAAGATTCCAGG + Intergenic
1050293387 9:4180153-4180175 GAGAACAGAATGAGGGTTTCAGG + Intronic
1051343405 9:16131234-16131256 GAGACCAGAAAGAAGCCTCAGGG + Intergenic
1051914943 9:22197456-22197478 GAGGACAGGAAGAAGTTTGAAGG + Intergenic
1053540965 9:38973360-38973382 GAGAACAGATTGAAGCTTTGAGG - Intergenic
1054625174 9:67390547-67390569 GAGAACAGATTGAAGCTTTGAGG + Intergenic
1056400033 9:86217925-86217947 AAGAACAAAGAGAAGGTTGCAGG - Intergenic
1057055815 9:91959864-91959886 AAGAACAGAGAGAAGCAGGCTGG - Intergenic
1057414167 9:94846607-94846629 GCAAAGAGAAAGAAGCTGGCTGG + Intronic
1057442614 9:95092737-95092759 GAGAGCAGAAAGGAACTTTCTGG - Intergenic
1057784700 9:98078033-98078055 GGGAACAGAGAGGAGCTTGTTGG - Intronic
1059695832 9:116729242-116729264 GAGACCAGAAAGAGGCCTGGAGG - Intronic
1062309845 9:135929784-135929806 GGGCACAGAAAGCTGCTTGCAGG + Intergenic
1062501747 9:136854755-136854777 GAGACCAGGAAGGAGCCTGCGGG - Exonic
1062616273 9:137397572-137397594 GAGAACAGAAAGCAACTTCGAGG + Intronic
1062649591 9:137568730-137568752 GGGAACAGAAAGAAGCCTGCAGG + Intronic
1187018514 X:15354752-15354774 GAGAAAACAAAGAAGATTCCTGG - Intronic
1187392504 X:18895398-18895420 GAGATCTGAAAGATGCCTGCTGG - Intronic
1187418078 X:19110741-19110763 GAGGACAGAAAGAACATTCCAGG + Intronic
1188131487 X:26439332-26439354 GTTACCAGAAAGAAGCTTGTGGG - Intergenic
1189505333 X:41607730-41607752 GAGAACATGGAGAATCTTGCAGG - Intronic
1190449903 X:50568768-50568790 AAGGACACAAAGAAGCTTCCAGG - Intergenic
1191840749 X:65512228-65512250 GAGAACAGCAGGAAGCCTGCTGG + Intergenic
1195618220 X:106929519-106929541 GGGAACAGAAAGCAGGATGCAGG + Exonic
1195754191 X:108184827-108184849 GTGAACAGAAGGAAGCTTGCAGG - Intronic
1197854561 X:130901683-130901705 GAGAACACAAAGAAGTGTGATGG - Exonic
1198411158 X:136369938-136369960 GAGAACAGAAAGTTGTTTGCAGG + Intronic
1199254548 X:145704036-145704058 GAGAACAGAATAAAGAGTGCAGG + Intergenic
1199267715 X:145847766-145847788 GAGAACAGTCACAAGCTTGGTGG + Intergenic
1199297925 X:146180352-146180374 AAGAACAGAAAGGACCTTGTAGG - Intergenic
1200099690 X:153684480-153684502 GAGAACAGAAAGAATGGGGCTGG - Intronic
1200395736 X:155986531-155986553 GATAACTGAAAGAAGCTCGGTGG - Intergenic
1200946160 Y:8840683-8840705 GAAAACAGAACTAAGCTTCCTGG - Intergenic
1201419913 Y:13787230-13787252 AAGGACAGAAAGTAGATTGCAGG - Intergenic
1201753673 Y:17463205-17463227 AAGAACAGAAAGCAACTTGGAGG - Intergenic
1201789728 Y:17826137-17826159 GAGGACAGAAACAGGCTTTCAGG + Intergenic
1201811826 Y:18079852-18079874 GAGGACAGAAACAGGCTTTCAGG - Intergenic
1201847880 Y:18442778-18442800 AAGAACAGAAAGCAACTTGGAGG + Intergenic
1202282278 Y:23202285-23202307 GAGAAAAGAAGTAACCTTGCAGG + Intergenic
1202283613 Y:23216234-23216256 GAGAAAAGAAGTAACCTTGCAGG - Intergenic
1202433949 Y:24816670-24816692 GAGAAAAGAAGTAACCTTGCAGG + Intergenic
1202435290 Y:24830620-24830642 GAGAAAAGAAGTAACCTTGCAGG - Intergenic