ID: 935138819

View in Genome Browser
Species Human (GRCh38)
Location 2:100333142-100333164
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1889
Summary {0: 31, 1: 72, 2: 122, 3: 416, 4: 1248}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935138819 Original CRISPR ATGGGGAGCCAGAAGGGGGA TGG (reversed) Intergenic
900145593 1:1157561-1157583 GTGTGGAGCAGGAAGGGGGAAGG + Intergenic
900342832 1:2196945-2196967 GTTGGGAGCCAGAGTGGGGAAGG - Intronic
900745400 1:4357266-4357288 TAGGGGAGCCAGAAGGGAGATGG - Intergenic
900792212 1:4688080-4688102 GTGGGGAGCCAGGATGGGGAAGG + Intronic
900803787 1:4754418-4754440 GTGGGTAGCCAGAAGGGAAAGGG - Intronic
900940904 1:5798096-5798118 ATGGGGAGAGAGGAGGTGGAGGG + Intergenic
901194465 1:7432748-7432770 ATGCAGGGCCACAAGGGGGACGG - Intronic
901266443 1:7914239-7914261 ACGGGGAGGGGGAAGGGGGAGGG - Intergenic
901469519 1:9446585-9446607 ATGGCAAGCGAGAAGGGGGTTGG - Intergenic
902006481 1:13236370-13236392 AAGGGGAGTTAGAAAGGGGATGG + Intergenic
902025534 1:13380755-13380777 AAGGGGAGTTAGAAAGGGGATGG + Intergenic
902598492 1:17525176-17525198 ATGGGGAGGGAGGAGAGGGAGGG + Intergenic
902749738 1:18499451-18499473 ATGGGGACCTGGAAAGGGGAAGG - Intergenic
903293026 1:22326597-22326619 AAGGGGACCCAGAAGTGTGAGGG - Intergenic
903360426 1:22773571-22773593 ATTGGGGGCCAGCTGGGGGAAGG - Intronic
903614101 1:24639657-24639679 ATGGGAAACCAGAAGGTTGAAGG + Intronic
903751949 1:25628749-25628771 TTGGAGACTCAGAAGGGGGAGGG - Intronic
904526306 1:31136395-31136417 ATGGGGAGCAGGAAAGGGGATGG - Intergenic
904577993 1:31517809-31517831 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
905310688 1:37046903-37046925 GTGGGGGGTCAGAAGGAGGAGGG + Intergenic
905558707 1:38908948-38908970 TGGGGTAGCCAGAAGGCGGATGG + Intronic
905792012 1:40794849-40794871 CTGTGGAGCCAGAAGAGGGAGGG + Intronic
905830193 1:41059500-41059522 ATGGGGAGCTGGAAAGGGGATGG - Intronic
905878057 1:41445979-41446001 TTGGGGATCTTGAAGGGGGAAGG - Intergenic
906138775 1:43520648-43520670 GTGGGGAGCTGGATGGGGGAGGG + Intergenic
906280407 1:44549598-44549620 ATGGGGAAGCAGAACTGGGAGGG - Intronic
906328040 1:44860774-44860796 ATGGGCAGCTGGAAGGGAGAAGG + Intronic
906476642 1:46173681-46173703 ATTAGGAACCTGAAGGGGGAGGG + Intronic
906601839 1:47137367-47137389 GTGGGGAGAGTGAAGGGGGAGGG - Intergenic
906693821 1:47810904-47810926 ATGGGCAGGCAGAAGGGAAAGGG - Intronic
906727746 1:48056045-48056067 AGGTGGAGGCAGAAGAGGGAGGG - Intergenic
906736161 1:48130938-48130960 ATGGAGACTCAGAAGGGTGAGGG - Intergenic
906751580 1:48267498-48267520 ATGGGGAGCTAGAAGGGGGATGG + Intergenic
906953205 1:50350783-50350805 ATGGGGAGTCAGAAGGGGGATGG - Intergenic
907236799 1:53056824-53056846 TTGGGGAGGCAGAAGGTGGGAGG - Intergenic
907394291 1:54178531-54178553 ATGTGGAGTCAGAGGGAGGAGGG + Intronic
907490396 1:54805658-54805680 AAGGAGAGCCAGAGGGTGGAGGG - Intergenic
907814340 1:57903503-57903525 TTGGGGAGAAAGAAGGTGGAAGG - Intronic
908006303 1:59732653-59732675 AAGGGGGGCAAGAAAGGGGAAGG + Intronic
908059616 1:60333459-60333481 GTGGGGAGCTAGAAAGGGGCTGG - Intergenic
908182391 1:61618883-61618905 ATGGGCAGGCAGAAGGGGGAGGG + Intergenic
908269895 1:62412327-62412349 ATAGGGAGCTGGAAGGTGGAGGG - Intergenic
908780967 1:67689347-67689369 CAGGGGAGCCATAAGGGGGACGG - Intergenic
908836059 1:68231175-68231197 ATGGGGAGACAGTGAGGGGAAGG + Intronic
908892116 1:68860041-68860063 ATGCGGAACCAGAAGGGCGATGG + Intergenic
908896777 1:68909963-68909985 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
909086447 1:71174281-71174303 GTGGGGAGCTGGAAGGAGGATGG + Intergenic
909094504 1:71270832-71270854 ATGGAGAGCTGGAAAGGGGATGG + Intergenic
909359413 1:74743687-74743709 GTGGGGAGCCATACTGGGGATGG + Intronic
909486591 1:76180779-76180801 ATGGGGAGCTAGACAGGAGATGG - Intronic
909742288 1:79045379-79045401 TAGGGGAGCCAGAAGGGAGATGG + Intergenic
909770917 1:79420138-79420160 GTGGGGTGCCGGAAGGGGGAAGG + Intergenic
909862997 1:80632646-80632668 ATGGGGAGCCAGAGGGGAGATGG - Intergenic
909917405 1:81337113-81337135 ATGGAGAGCTGGAAAGGGGATGG - Intronic
909920946 1:81379546-81379568 TAGGGGAGCCAAAAGGGAGATGG + Intronic
909986953 1:82172906-82172928 AAGGGGAGTTGGAAGGGGGATGG - Intergenic
910050945 1:82973446-82973468 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
910149623 1:84126342-84126364 ATGGGGAGCTGGAAAGCGGATGG + Intronic
910442343 1:87265710-87265732 ATGGGGACTGAGAAGGTGGAAGG + Intergenic
910477201 1:87620062-87620084 TGGGGGAGACAGAAGGGAGATGG - Intergenic
910630009 1:89344631-89344653 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
910840680 1:91558426-91558448 TTGGGGAGGGGGAAGGGGGATGG - Intergenic
911090069 1:94011069-94011091 CTGGGGAGCCACAGGAGGGATGG - Intronic
911310701 1:96289065-96289087 AATGGCAGTCAGAAGGGGGATGG + Intergenic
911335439 1:96575177-96575199 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
911430028 1:97773781-97773803 ATGGGGAGCTAGAAGGGGGATGG - Intronic
911587220 1:99704878-99704900 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
911764448 1:101657004-101657026 ATGGGGAGCCAGAAAGGGGATGG + Intergenic
912002769 1:104856047-104856069 GATGGGAGCCAAAAGGGGGATGG + Intergenic
912612865 1:111066481-111066503 ATGGGAAGCTTGAAAGGGGATGG - Intergenic
912875565 1:113355199-113355221 CTTGGGAGGCAGAAGTGGGAGGG - Intergenic
913097675 1:115534848-115534870 AGGGGGAGCTGGAAAGGGGATGG - Intergenic
913171446 1:116235930-116235952 TTGAAGAGCCAGAAGTGGGAAGG - Intergenic
913199427 1:116484058-116484080 ATGTGGGGGCAGGAGGGGGAGGG + Intergenic
913322918 1:117601949-117601971 GTAGGGATCCAGAAGGGGGATGG - Intergenic
913457604 1:119049290-119049312 TGGGGGAGCCAGAAGGGAGATGG - Intronic
914214604 1:145613892-145613914 ATGGGGAGGCTGAAGTGGAAGGG - Intronic
914466546 1:147934282-147934304 ATGGGGAGGCTGAAGTGGAAGGG - Intronic
914542820 1:148632287-148632309 TTTGGGAGGCAGAAGTGGGAGGG + Intronic
914704789 1:150161731-150161753 CAGGGGAGCCAGAAGATGGAGGG + Intronic
914780370 1:150780320-150780342 TTGAGGGGCCAGAAGTGGGAGGG - Intergenic
914818852 1:151084152-151084174 TTAGGGAGGCAGAAGTGGGAGGG - Intronic
914902258 1:151717002-151717024 CTGGGGAGTAAGATGGGGGAAGG - Intronic
915062142 1:153195071-153195093 TTGGGGACCCAGAAGGGGACTGG - Intergenic
915246845 1:154561681-154561703 ATAGGGATCAAGAAGGGGAACGG + Intergenic
915345588 1:155195304-155195326 ATGGAGAGCCAGGAGGGCGGGGG - Intergenic
915468096 1:156109446-156109468 ATGGGGAGCCACTAGAGGTAAGG - Intronic
915631737 1:157157954-157157976 ACTGGGACCCAGCAGGGGGATGG - Intergenic
915835697 1:159173087-159173109 GTGGGGAGAGTGAAGGGGGAGGG + Intronic
915953432 1:160205263-160205285 ATGGAGAGGCAGGAGGGGGCGGG - Intergenic
916284718 1:163093733-163093755 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
916384255 1:164249739-164249761 ATGGGGAGCTGGAAAGGGGCTGG - Intergenic
916694436 1:167221438-167221460 GTGGGGGGCGTGAAGGGGGATGG + Intronic
916705166 1:167341871-167341893 ATGGGGAGCTGGAAAGGGAATGG + Intronic
916841950 1:168609862-168609884 CTGAGGAGACAGAGGGGGGAGGG + Intergenic
916951576 1:169785489-169785511 ATGGGGAGCTGGAAGGGGGATGG + Intronic
917087576 1:171319196-171319218 CTGGGGAGCTGGAAAGGGGATGG + Intronic
917099532 1:171431447-171431469 ATGGGCAGCTAGAAAGGGGATGG + Intergenic
917141733 1:171841893-171841915 AGCGGGAGCCAGAGGGTGGATGG + Intronic
917193544 1:172443845-172443867 ATGGGGTGCCAGAAGAGTGAAGG - Exonic
917211022 1:172632100-172632122 ATGGGGAACTGGAAAGGGGATGG - Intergenic
917254863 1:173103599-173103621 TGGGGAAGTCAGAAGGGGGATGG + Intergenic
917588922 1:176457337-176457359 ATAGGGAGCTGGAAAGGGGATGG + Intergenic
917589195 1:176459637-176459659 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
918188141 1:182145593-182145615 GTGGGGAGACAGAAAGAGGAAGG + Intergenic
918291803 1:183115776-183115798 ATGGTGAGCCACAAGGGGTTTGG + Intronic
918362363 1:183772072-183772094 TGGGGGAGCCAGAAGGGAGATGG - Intronic
918384028 1:183986897-183986919 GTGGGGAGCCTGGAGTGGGAGGG - Intronic
918761847 1:188420536-188420558 AGGGAGAGACAGAAGGAGGAAGG - Intergenic
918809284 1:189094445-189094467 CTGGGGAGCCAGAAGGGAGATGG - Intergenic
918813359 1:189149952-189149974 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
918928876 1:190826700-190826722 ATGGAGATTCAGAAGGGTGAGGG + Intergenic
918990501 1:191692713-191692735 GAGGGGAGCTGGAAGGGGGATGG - Intergenic
919048162 1:192480347-192480369 ATGGGGAGCTAGAAGGGGGATGG - Intergenic
919110888 1:193217436-193217458 TAGGGGAGCCAGAAAGGGGATGG + Intronic
919199891 1:194342756-194342778 ATCGGGAGACAGAAGGGGGATGG - Intergenic
919211611 1:194494144-194494166 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
919656317 1:200200719-200200741 ATGGGGAGCTGGAAAGGAGATGG - Intergenic
919804307 1:201371987-201372009 GTGGAGAGCCAGAAAGGGGCAGG - Intronic
919899568 1:202034216-202034238 ATGAGATGCCAGACGGGGGAGGG + Intergenic
919982040 1:202647820-202647842 AGGGGGAGGGAGGAGGGGGAAGG - Intronic
920255611 1:204652219-204652241 AAGGGGAGAGAGGAGGGGGAAGG - Intronic
920461105 1:206141140-206141162 ATGCGGAGTTAGAAGGGGGATGG - Intergenic
920611143 1:207438966-207438988 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
920756452 1:208738385-208738407 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
920950351 1:210566711-210566733 ATAGGGAGCTGGAAGGGGAATGG - Intronic
921092199 1:211854982-211855004 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
921116158 1:212093500-212093522 TGGGGGAGCCAGAAGGGAAATGG + Intronic
921221714 1:212978371-212978393 ATGGGGAGAAAGACTGGGGAAGG + Intronic
921362348 1:214341572-214341594 ATGGCCAGGCAGAAGGGGAATGG - Intergenic
921390945 1:214612915-214612937 ATGGGGGGCAGGAAGGGGAAGGG + Intronic
921403533 1:214753476-214753498 ATGGGGAGCCAGAAGAGGGATGG - Intergenic
921422066 1:214959677-214959699 AAGTGGAGGCAGAAGGGAGAGGG + Intergenic
921456807 1:215380803-215380825 AAGGGGAGGAAGAAGTGGGAAGG + Intergenic
921632884 1:217456015-217456037 ATGGGGAGCTGGGAAGGGGACGG - Intronic
921891011 1:220353491-220353513 ATGGGGAGCCACAAGCGGTATGG - Intergenic
922223761 1:223627926-223627948 GTGGGGAGGCAGACGTGGGAGGG + Intronic
922334298 1:224606376-224606398 ATGGGGAGCTGGAAAGGGGATGG + Intronic
922799832 1:228360135-228360157 ATGGGCAGCCTGGAGGAGGAGGG + Intronic
923252676 1:232191852-232191874 AGGGGAAGCCAGAAGGGGGATGG - Intergenic
923383787 1:233447029-233447051 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
923482471 1:234397500-234397522 AGGGGGAGGGGGAAGGGGGATGG + Intronic
923601693 1:235409241-235409263 ATTGGTAGGCAGAAGGAGGAAGG + Intronic
923853228 1:237819574-237819596 TTTGGGAGGCTGAAGGGGGATGG + Intronic
923975481 1:239257319-239257341 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
924108113 1:240669712-240669734 ATGGAGACTCAGAAGGGTGAAGG - Intergenic
924501506 1:244642824-244642846 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
924606324 1:245538614-245538636 ATGGAGAGACAGACAGGGGAAGG - Intronic
924697796 1:246418664-246418686 TGGGGGAGCCAGAAGGGAAATGG + Intronic
924718740 1:246603766-246603788 CTAGGGAGGCAGTAGGGGGATGG + Intronic
1062815076 10:493449-493471 GGGGGGAGCGAGAAGGGGCAAGG + Intronic
1062833577 10:622257-622279 AGGGGGAGGGAGGAGGGGGAGGG + Intronic
1062833584 10:622270-622292 AGGGGGAGGGAGGAGGGGGAGGG + Intronic
1063131887 10:3185459-3185481 ATGGGGAGCTGGAAAGGGAATGG - Intergenic
1063233245 10:4086728-4086750 CGGGGGAGGCAGAAGAGGGACGG - Intergenic
1063357747 10:5417052-5417074 TGGGGGAGCCAGAAGGGAAATGG + Intronic
1063523401 10:6761120-6761142 ATGGGGAGTTGGAAGGGGGATGG - Intergenic
1063906430 10:10784493-10784515 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1064125781 10:12658790-12658812 AGGGGAGGCCAGAAGGGGAATGG - Intronic
1064599347 10:16977514-16977536 ATGGGGAGCTGGAAAGGGGGTGG - Intronic
1064600178 10:16985398-16985420 ATGGGGAACTGGAAAGGGGATGG - Intronic
1064682459 10:17824830-17824852 ATGGGGAAACAGAAAGGGTAGGG - Intronic
1064705610 10:18069709-18069731 ATAGGGAGCTGGAAGGGGAATGG - Intergenic
1064795817 10:19010040-19010062 ATGGGGAGCCAGAAGAGGTATGG + Intergenic
1064955500 10:20903856-20903878 ATGGAGACTCAGAAGGGAGAAGG + Intronic
1065009138 10:21405964-21405986 ATGGGGAGTTGGAAAGGGGATGG - Intergenic
1065371515 10:24991631-24991653 TGGGAGAGCCAGAAGGGAGATGG - Intronic
1065454402 10:25891951-25891973 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1065778297 10:29142975-29142997 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1065792978 10:29278673-29278695 ATGGGGAGCCTGAGGGGTGGGGG + Intergenic
1066047198 10:31604044-31604066 ATGGGGAGGCAACAGGAGGAGGG - Intergenic
1066212336 10:33252229-33252251 TGGGGGAGCCGGAAGGGAGATGG - Intronic
1066251471 10:33637281-33637303 ATGGGGAGTTGGAAAGGGGATGG - Intergenic
1066305115 10:34133016-34133038 ATGGGAAGCTGGAAAGGGGATGG - Intronic
1066444499 10:35469654-35469676 ATGGAGAGTCAGACGGGAGATGG + Intronic
1067272650 10:44805426-44805448 CTGGGGATCCAGCAGGGGAAAGG + Intergenic
1067897627 10:50201161-50201183 ATGGGGAGCTGGAAAGGGGATGG - Intronic
1067935266 10:50605904-50605926 ATGGAGACTCAGAAGGGTGAAGG - Intronic
1068134677 10:52940128-52940150 TGGGGGAGCCGGAAGGGAGATGG - Intergenic
1068258330 10:54543143-54543165 TGGGGGAGCCAGAAGGGAGATGG - Intronic
1068318848 10:55383134-55383156 AAGGGGAGCTGGAAAGGGGATGG + Intronic
1068497902 10:57808387-57808409 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1068607924 10:59026274-59026296 TGGGGGAGCCAGAAGGTAGATGG - Intergenic
1068640260 10:59396956-59396978 ATGGAGACTCAGAAGGGTGAGGG - Intergenic
1068944931 10:62720240-62720262 GTGGGGAGCCTGAAGGGGTGAGG - Intergenic
1068947251 10:62741909-62741931 ATATGGAGGCAGAAGAGGGAGGG - Intergenic
1069209080 10:65733605-65733627 TGGGGCAGCCAGAAGGGAGATGG - Intergenic
1069601061 10:69708449-69708471 ACGGGGAGCTGGAAAGGGGATGG - Intergenic
1069623667 10:69853276-69853298 CTGGGGTGCCAGGTGGGGGATGG - Intronic
1069654720 10:70079316-70079338 ATGGGCAGCCAGGTGGGGAAGGG + Intronic
1069807928 10:71137604-71137626 ATGAGGGGACAGGAGGGGGAAGG - Intergenic
1069870779 10:71531619-71531641 ATGGGGAGCCAGGCTGGGTAGGG + Intronic
1070363845 10:75716997-75717019 ATGGGGAGAGAGAAAGGGGATGG - Intronic
1070669265 10:78366662-78366684 ATGGGGAGAGGGAAGGGGGTAGG + Intergenic
1071023403 10:81083953-81083975 ATGGGGAGCCACAAGGGCCTTGG - Intergenic
1071028133 10:81139979-81140001 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1071038763 10:81280949-81280971 CAGGGGAGACAGTAGGGGGATGG + Intergenic
1071220421 10:83459018-83459040 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1071486850 10:86107872-86107894 TGGGGGAGCAAGAAGGGAGATGG - Intronic
1071490121 10:86130629-86130651 ATGGGGAGCTGGAAAGGGGTTGG - Intronic
1071834870 10:89408885-89408907 GTGGGGATCCATAATGGGGATGG - Intronic
1071893797 10:90041989-90042011 GATGGGAGCCAGAATGGGGATGG + Intergenic
1071960383 10:90804196-90804218 AAGGGGAGCTGGAAAGGGGATGG - Intronic
1072108022 10:92291830-92291852 TTGGGGAGGGGGAAGGGGGAGGG - Intronic
1072223104 10:93344405-93344427 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1072897177 10:99376991-99377013 GTGGGGAGGAAGAAGGGGGAGGG - Intronic
1072972031 10:100025696-100025718 ATGTGGAGCTGGAAAGGGGATGG + Intergenic
1073358297 10:102874781-102874803 AAGGGGTGGCAAAAGGGGGAAGG + Intronic
1073428435 10:103470658-103470680 ATGGGGAGTTAGCAGGGAGAAGG - Intergenic
1073735076 10:106336273-106336295 ATGGTGAGCTGGAAAGGGGATGG - Intergenic
1074162656 10:110846893-110846915 ATGTGGAGCTGGAAGGAGGAAGG - Intergenic
1074259507 10:111837886-111837908 ATAGGAAGCCAAAAGTGGGAGGG - Intergenic
1074710049 10:116169681-116169703 ATGTGGAGCTGGAAAGGGGATGG - Intronic
1075284483 10:121171785-121171807 AAGGGAAGGCAGAAGGGGAAGGG + Intergenic
1075585434 10:123653789-123653811 AGGGGAAGGGAGAAGGGGGAAGG + Intergenic
1075648270 10:124110570-124110592 TTCGGGAGCCAGAAGCAGGAAGG + Intergenic
1075848671 10:125568069-125568091 ATGGGGAGCTGGAAAGGAGATGG - Intergenic
1075992113 10:126846798-126846820 GTGGGGAGTCAGGACGGGGATGG - Intergenic
1076102512 10:127794398-127794420 ATGGGGAGCTGGAAAGGGAATGG - Intergenic
1076838411 10:133032723-133032745 ATGAGGAGGGAGAAGGGGGCAGG - Intergenic
1076856020 10:133115987-133116009 ATGGGGAGGGAAAAGAGGGAGGG - Intronic
1077283227 11:1754726-1754748 ATGGGGAGCATGGAGGGGCAAGG + Intronic
1077368474 11:2170789-2170811 ATGGGGAGCCTGGTGGGGGAGGG + Intronic
1077471132 11:2761134-2761156 TGGGGGAGCAAGAAGGGAGATGG + Intronic
1077586705 11:3459388-3459410 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1077712440 11:4550836-4550858 GTGGGGAGCTGGAAAGGGGATGG - Intergenic
1077712978 11:4554366-4554388 GTGGGGAGCCGGAAAGGGGATGG - Intergenic
1077901987 11:6497234-6497256 CGGGGGAGCCAGAAAGAGGAGGG - Intronic
1078113927 11:8426178-8426200 ATGGGGAGCCAGAAGGGAGATGG + Intronic
1078427002 11:11260075-11260097 GTGGGGAGCCAGAGGAGTGAAGG - Intergenic
1078703685 11:13717144-13717166 ATGGGGAGGCGCGAGGGGGAAGG - Intronic
1078736354 11:14024425-14024447 ATGGGGGGCCAGAAGAGGGATGG + Intronic
1079251597 11:18791471-18791493 GTGCGGAGCCGGAAGGTGGAGGG - Intronic
1079538080 11:21539519-21539541 ATGCGGAGCTGGAAAGGGGATGG + Intronic
1079929260 11:26537579-26537601 ATGGGGAGACAGAAGGCCCATGG - Intronic
1080723830 11:34875094-34875116 ATGGGGAGCTGGAAAGAGGATGG - Intronic
1081033446 11:38114002-38114024 GTGGGGATCCATAATGGGGACGG - Intergenic
1081061354 11:38481701-38481723 TGGGGCAGCCAGAAGGGAGATGG - Intergenic
1081279205 11:41187509-41187531 TGGGGAGGCCAGAAGGGGGATGG - Intronic
1081312586 11:41592129-41592151 ATGAGGAGCTGGAAGGGGGATGG + Intergenic
1081329993 11:41790749-41790771 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1081352092 11:42066401-42066423 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1081374211 11:42339858-42339880 ATAGGGAGCTGGAAAGGGGATGG - Intergenic
1081492191 11:43577596-43577618 ATGGGGGGCATGAAGTGGGAGGG - Intronic
1081567395 11:44268515-44268537 ATTGGGAGCCCAACGGGGGAGGG + Intronic
1082132370 11:48506231-48506253 AGGGGGAGAGGGAAGGGGGAAGG - Intergenic
1082565833 11:54676851-54676873 AGGGGGAGAGGGAAGGGGGAAGG - Intergenic
1082710365 11:56547301-56547323 ATGGGGAGCCAGAAAGGGGACGG - Intergenic
1082749764 11:57003130-57003152 ATGGGGAGCCGGAAAGGCGATGG + Intergenic
1082751418 11:57022501-57022523 ATGGGGAGCTGAAAGGGGGATGG + Intergenic
1083107647 11:60373932-60373954 ACAGGGAGCCAGAACGGGGATGG - Intronic
1083764433 11:64835278-64835300 ATGGGGAGCCAGTTGAGGGGTGG - Intronic
1084209954 11:67616256-67616278 ATGGGGACCCAGACGGGGGGCGG + Intergenic
1084242702 11:67833420-67833442 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1084480820 11:69419061-69419083 ATGGGGAGCCTGAAGTGTGCGGG + Intergenic
1084698173 11:70768731-70768753 ATGGGGAGCCTGGAGATGGAGGG + Intronic
1084830299 11:71763584-71763606 TGGGGGAGTCAGAAGGGAGATGG - Intergenic
1084927041 11:72522278-72522300 TCAGGGAGCCAGAAGGGAGATGG + Intergenic
1085047099 11:73359974-73359996 CTGGGGAGCCAGAGGGTGGGAGG + Intronic
1085271568 11:75273068-75273090 GTGGCTAGCCAGATGGGGGATGG - Intronic
1085348015 11:75780633-75780655 GTGGGGAGCTGGAAGGGGAAGGG - Intronic
1085579493 11:77637920-77637942 ATGGCGAGGAAGAAGGGGAAGGG - Intergenic
1085684076 11:78605830-78605852 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1085947009 11:81284459-81284481 ATGGGAAGCTGGAAAGGGGATGG - Intergenic
1086001851 11:81993082-81993104 TAGGGGAGCCGGAAGGGAGATGG - Intergenic
1086311504 11:85540490-85540512 ATGGGGAGGCCAGAGGGGGATGG - Intronic
1086476084 11:87176267-87176289 ATGGGGAGACAGGAAGGGGCAGG - Intronic
1086605909 11:88696114-88696136 TGGGGAGGCCAGAAGGGGGATGG + Intronic
1086685359 11:89727900-89727922 CTGGGAAGCGGGAAGGGGGATGG + Intergenic
1087140015 11:94756013-94756035 ACGGGAAACCAGAAAGGGGATGG + Intronic
1087328006 11:96746849-96746871 TGGGGGAGCCAGAAGGCAGATGG - Intergenic
1087335526 11:96839605-96839627 ATGGGGAGCCAGAAGGGAGATGG + Intergenic
1087396617 11:97609145-97609167 ATGGGGAGCTGGAAGGGAGATGG + Intergenic
1087396970 11:97611384-97611406 ATGTGGAGCCAGAAAGGGTATGG + Intergenic
1087461946 11:98456760-98456782 TGGCGGAGCCAGAAGGGAGATGG + Intergenic
1087677090 11:101175682-101175704 GTGGGGAGCCAGAAAGGGGATGG - Intergenic
1087698784 11:101412399-101412421 ATGGCGAGCTGGAAAGGGGATGG - Intergenic
1087788722 11:102384736-102384758 TGAGGGAGCCAGAAGGGAGATGG + Intergenic
1087933706 11:104006795-104006817 ATAGGGAGCTGGAAGGGGGATGG - Intronic
1088103234 11:106177224-106177246 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1088238530 11:107750409-107750431 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1088257748 11:107916796-107916818 ATGTGGAGCCAGAAGGAGGATGG - Intronic
1088428337 11:109729693-109729715 AAGGGGAGCTGGAAAGGGGATGG - Intergenic
1088450618 11:109977747-109977769 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1088507306 11:110539294-110539316 TGGGGGGGCCAGAAGGGAGATGG + Intergenic
1088716812 11:112555865-112555887 CTGAGCAGCCAGAAGGGTGAGGG - Intergenic
1088777594 11:113100548-113100570 ATGGAGAGCTGGAAAGGGGATGG + Intronic
1088920266 11:114255477-114255499 ACGGGGAGCCAGAGGGAGGAGGG - Intergenic
1088996148 11:114999042-114999064 ATGCAGAGCCAGGAGGAGGAAGG + Intergenic
1089031044 11:115329807-115329829 ATAGGGAGCCGGAAAGGAGATGG + Intronic
1089051372 11:115548898-115548920 ATGGTGAGCCAGAGGAAGGAGGG + Intergenic
1089078553 11:115758671-115758693 ACGGGGATCCAGAAGGCCGAGGG + Intergenic
1089556068 11:119316577-119316599 ATGCCCAGGCAGAAGGGGGAAGG + Intronic
1089629101 11:119772733-119772755 ATGGGGTGGCAGCAGGAGGAGGG + Intergenic
1089668359 11:120034510-120034532 ATGGGGAGAGAGAAGGAGGCAGG - Intergenic
1090124294 11:124069839-124069861 ATGGGGAGCCAGAAGGGGAGCGG + Intergenic
1090135852 11:124198752-124198774 AAGGGGAGCTGGAAGGGGGATGG - Intergenic
1090554123 11:127855597-127855619 ATGGGGAGCTAGAAAGAGGATGG + Intergenic
1090678912 11:129031994-129032016 ATGGGGAGCTGGAAAGGGGATGG - Intronic
1091312446 11:134584405-134584427 GTGGGGAGGCAGCAGGGGGGTGG - Intergenic
1091526713 12:1309596-1309618 AAAGGGAGAGAGAAGGGGGAAGG - Intronic
1091635623 12:2194371-2194393 AGGGGGAGCAGGAAGGGGAAGGG - Intronic
1091663166 12:2399442-2399464 ATGGGGAGCTTGAAAGGGGATGG + Intronic
1091770855 12:3150351-3150373 ATGGGGGGCAGGAATGGGGAGGG + Intronic
1091780819 12:3213626-3213648 AAGGGGGGCTGGAAGGGGGAGGG - Intronic
1091787480 12:3251867-3251889 ATACGGAGCCAGAAGGGGCTGGG + Intronic
1091812891 12:3414720-3414742 ATGGGGAGTTGGAAAGGGGATGG + Intronic
1091835933 12:3585799-3585821 AGGAGCAGCCAGGAGGGGGAAGG + Intronic
1091966146 12:4743539-4743561 ATGGGGAGAGAGGAGAGGGAGGG + Intronic
1092027761 12:5257380-5257402 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1092196436 12:6552341-6552363 GTGGGGAGCCAGCAGGGTGGTGG - Intronic
1092204813 12:6608205-6608227 CTGTGGAGCTAGAAGAGGGAAGG - Intergenic
1092236876 12:6815965-6815987 ATGTGGAGGCAGCAGGGAGATGG - Intronic
1092412936 12:8268121-8268143 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1092882889 12:12901487-12901509 AAGGGGAGTCAGGAGGAGGACGG - Intronic
1093089390 12:14904508-14904530 TGGGGGAGCCAGAAGGGAGATGG - Intronic
1093184664 12:16006205-16006227 ATTGGGAGCAAGAGGGGAGAGGG - Intronic
1093245441 12:16730672-16730694 ATGGGGAGCATGAAACGGGATGG - Intergenic
1093348953 12:18072635-18072657 ATGGGGAGCCAGAAGGGGAGTGG + Intergenic
1093369695 12:18352721-18352743 ATGGAGAGCTAGAAAGGGGATGG + Intronic
1093509035 12:19904135-19904157 TGGGGGAGCCAGAAGAGAGATGG - Intergenic
1093749237 12:22779559-22779581 ATGGGGAACTGGAAAGGGGATGG + Intergenic
1093769100 12:22998980-22999002 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1093937760 12:25019410-25019432 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1093977971 12:25443907-25443929 TTGGAGACTCAGAAGGGGGAAGG - Intronic
1094111395 12:26866458-26866480 CTGGGGAGGCTGAAGTGGGAGGG - Intergenic
1094143975 12:27209624-27209646 ATGGAGGCTCAGAAGGGGGAGGG + Intergenic
1094249288 12:28340964-28340986 TGGGGTAGCCAGAAGGGAGATGG + Intronic
1094322101 12:29195858-29195880 ATGGGGACTCAGAAGGACGAGGG - Intronic
1094361734 12:29638400-29638422 ATGGGGATCCAGAAGGGAGATGG - Intronic
1094406473 12:30121538-30121560 ATGGGGAGCCAAAAGGGGGATGG - Intergenic
1094412602 12:30182931-30182953 ATGGGGAGCTGGAAAGGGAATGG - Intergenic
1094474979 12:30833880-30833902 ATGGGGCGCTGGAAAGGGGATGG - Intergenic
1094555678 12:31497774-31497796 ATGGGGAGGGTGGAGGGGGAGGG + Intronic
1094596769 12:31873251-31873273 ATGGAGAGCCAGACGGTGGGTGG + Intergenic
1094619895 12:32069979-32070001 ATGGGGACTCAGAAGGGTGGCGG - Intergenic
1094745605 12:33341227-33341249 ATGGGGAGCTGGAAAGGAGATGG + Intergenic
1095183836 12:39178402-39178424 ATGGGGAGCTGGTAGGGGGATGG - Intergenic
1095184613 12:39187047-39187069 CTGGGGACCCAGAAGGGAGATGG - Intergenic
1095500173 12:42829056-42829078 CTGGGGATCCAGCAGGGGGATGG + Intergenic
1095748097 12:45682162-45682184 ATGAGGAGGTGGAAGGGGGATGG - Intergenic
1095898620 12:47305496-47305518 TGGGGGATCCAGAAGGGAGACGG + Intergenic
1096171667 12:49476346-49476368 TGGGGGAGCCAGAAGGGAGACGG - Intronic
1096414430 12:51401379-51401401 TAGGGGAGCCAGAAGGGAGATGG + Intronic
1096423569 12:51481551-51481573 GTGGGGAGACAGCAGGGGGCAGG + Intronic
1096761001 12:53841949-53841971 ATGGGGAGCAAGAGTGAGGAGGG - Intergenic
1096777093 12:53970881-53970903 CTGGAGGGCCAGGAGGGGGAAGG + Intergenic
1096838804 12:54369024-54369046 AAAGGGAGCGAGAAGGAGGAGGG - Intergenic
1096848768 12:54422022-54422044 ATGGAGAGGAAGAAGGGTGAAGG + Intergenic
1097050427 12:56219907-56219929 CTGAGGAGGCTGAAGGGGGAAGG + Intronic
1097131128 12:56811347-56811369 GGGGGAAGCCAGAAAGGGGATGG + Intergenic
1097219279 12:57437743-57437765 ATGAGGGGCCAGAAATGGGAAGG - Intronic
1097290826 12:57913653-57913675 ATGGGGAACTGAAAGGGGGATGG - Intergenic
1097876273 12:64647162-64647184 CTGGGGTGCCAGGAGGTGGAGGG - Intronic
1097998676 12:65917657-65917679 AGGAAGAGACAGAAGGGGGAAGG + Intronic
1098314879 12:69182519-69182541 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1098396849 12:70028581-70028603 ATGGGGAGCTAGAAGGGGTATGG + Intergenic
1098547969 12:71731965-71731987 TGGGGGAGCAAGAAGGGGGATGG - Intergenic
1098744093 12:74213579-74213601 ACGGGGAGCAGGAAGGGGGATGG + Intergenic
1098757671 12:74386958-74386980 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1098758334 12:74391671-74391693 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1098992733 12:77082433-77082455 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
1099029822 12:77512250-77512272 ATGGGCAGGCACAAGGGGGAAGG + Intergenic
1099460024 12:82910649-82910671 ACGGAGGGCCAGAAGGGAGATGG + Intronic
1099499135 12:83389514-83389536 TGGGGGAGCCAGAAGGGAAATGG - Intergenic
1099653284 12:85456736-85456758 ATGGGGAGCCAGAAAGGGGATGG - Intergenic
1099882006 12:88478228-88478250 ATGGGGGGCCAGGGGAGGGAAGG + Intergenic
1100206373 12:92354412-92354434 ATGGGGAGCCAGCAGGGGGATGG - Intergenic
1100293065 12:93235779-93235801 AAGGGAAGCTGGAAGGGGGATGG - Intergenic
1100387012 12:94112949-94112971 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
1100478119 12:94952737-94952759 ATGAGGAGCCAGAAAGGGGATGG - Intronic
1100641291 12:96484416-96484438 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1100888400 12:99098251-99098273 ATGGGAAGCCAGTGGGGTGAGGG - Intronic
1100978504 12:100146035-100146057 ATGGGAAGCTGGAAAGGGGATGG + Intergenic
1101362367 12:104040146-104040168 ATGGGGTGGGAGCAGGGGGAGGG + Intronic
1101378039 12:104187853-104187875 ATGGGGAGTTGGAAAGGGGATGG + Intergenic
1101399926 12:104378306-104378328 TAGGGGACCCAGAAAGGGGAAGG + Intergenic
1101432826 12:104641127-104641149 AAGGGGAGCTAAAAAGGGGAAGG - Intronic
1101455187 12:104824461-104824483 TGGGGGAGCCAGAAGGGAGATGG - Intronic
1101455761 12:104828288-104828310 TGGGGGAGCCAGAAGGGAGATGG - Intronic
1101828178 12:108236953-108236975 GAGGGGAGACAGAAGAGGGAAGG + Intronic
1102065475 12:109971564-109971586 TTTGGGAGGCAGAAGGGGGTGGG - Intronic
1102086925 12:110149613-110149635 TAGGGGAGCCCGAAGGGAGATGG + Intronic
1102230239 12:111257225-111257247 AAGGGGAGGAAGAAGTGGGAGGG - Intronic
1102230290 12:111257385-111257407 AGGGGGAGGAAGAAGTGGGAGGG - Intronic
1102230297 12:111257404-111257426 AGGGGGAGGAAGAAGTGGGAGGG - Intronic
1102230304 12:111257423-111257445 AGGGGGAGGAAGAAGTGGGAGGG - Intronic
1102230311 12:111257442-111257464 AGGGGGAGGAAGAAGTGGGAGGG - Intronic
1102230318 12:111257461-111257483 AGGGGGAGGAAGAAGTGGGAGGG - Intronic
1102230325 12:111257480-111257502 AGGGGGAGGAAGAAGTGGGAGGG - Intronic
1102275034 12:111575418-111575440 ATGGGGAGGCTGAAATGGGAAGG - Intronic
1102558051 12:113741925-113741947 ATGGAGAGAGAGAAGGGGAAGGG + Intergenic
1102786118 12:115606349-115606371 AAGGGGAGAGAGGAGGGGGATGG + Intergenic
1102813190 12:115841705-115841727 GTGGGAAGAGAGAAGGGGGAAGG - Intergenic
1102823592 12:115927773-115927795 ATGTGCAGCCAGGATGGGGAGGG + Intergenic
1103166251 12:118773088-118773110 ATGGGGAGCGTGAAGGGGGATGG + Intergenic
1103277746 12:119727437-119727459 CTGTGGATTCAGAAGGGGGAAGG + Intronic
1103674408 12:122644378-122644400 TAGGGGAGCCAGAAAGGAGATGG + Intergenic
1103734732 12:123052986-123053008 CTTGGGAGGCTGAAGGGGGAGGG - Intronic
1104096813 12:125565602-125565624 GTGGGGAGCTGGAAGGGGGATGG + Intronic
1104143132 12:126007153-126007175 ATGGGGAGTTGGAAAGGGGATGG + Intergenic
1104238305 12:126961237-126961259 ATGGGGAGCCAGAAGGGAGATGG + Intergenic
1104754193 12:131258621-131258643 ATGGGGAGTCGGAAAGCGGAAGG + Intergenic
1105595158 13:21830613-21830635 AGGGGGAGGGAGAAGGGGAAAGG - Intergenic
1105972984 13:25447827-25447849 ATGGGGAGCTGGAGAGGGGATGG + Intronic
1106070523 13:26406963-26406985 CTGGACAGCCAGAAGGGGGGAGG - Intergenic
1106169854 13:27279754-27279776 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1106182961 13:27383879-27383901 CGGGGGAGCCAGAAGGGAGATGG - Intergenic
1106319457 13:28624353-28624375 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1106517360 13:30466297-30466319 ATGTGGGGCAAGAAGGGGGGGGG - Intronic
1106540988 13:30690092-30690114 GGGGGGAGCCAGAAAGGAGATGG - Intergenic
1106694884 13:32162706-32162728 ATTGGCAGCCAGAAGGTGGAAGG - Intronic
1106800869 13:33254817-33254839 ATGGGGAGCCAAAGAGGGGTTGG - Intronic
1106942294 13:34792309-34792331 ATGAGGAGCTGGAAAGGGGATGG - Intergenic
1107294389 13:38894320-38894342 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1107307581 13:39038611-39038633 ACGGGAAGCCAGGAGAGGGAGGG - Exonic
1107459103 13:40584074-40584096 AGGGGGAGACAGATGGGGAATGG + Intronic
1108008025 13:45972429-45972451 TTGGAGACTCAGAAGGGGGAGGG + Intronic
1108104850 13:46997833-46997855 ATGAGGAGCTAGAAAGAGGACGG + Intergenic
1108158984 13:47618500-47618522 ATGGAGAGCTGGAAAGGGGATGG + Intergenic
1108159056 13:47618897-47618919 ATGGGGAGTTGGAAAGGGGATGG - Intergenic
1108254640 13:48598550-48598572 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
1108346422 13:49551125-49551147 GGGGGGAGGGAGAAGGGGGAAGG + Intronic
1108394788 13:49981620-49981642 ATGGGGAGCCAGATCAGGTACGG - Intergenic
1108687718 13:52835271-52835293 ATGGGGAGGGGGAGGGGGGAAGG + Intergenic
1108799810 13:54081728-54081750 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1109075745 13:57832471-57832493 ATGAGGAGACAGAAGGGAGATGG - Intergenic
1109151702 13:58856592-58856614 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1109152430 13:58860916-58860938 TCAGGGAGCCAGAAGGGAGATGG + Intergenic
1109172876 13:59117960-59117982 TGGGGGAGCCAGAAGAGAGATGG + Intergenic
1109300723 13:60587355-60587377 ATGGGAAGCTGGAAAGGGGATGG - Intergenic
1109377922 13:61522833-61522855 ATGGAGAGCCAGAAGGTGGAGGG + Intergenic
1109378540 13:61526721-61526743 ACAGGGAGCCGGAAGGTGGAGGG + Intergenic
1109735929 13:66484057-66484079 TGGGGGAGCCAGAAGGGAGATGG - Intronic
1109784546 13:67156553-67156575 TGGGGGAGCCAGAAGGGAGATGG - Intronic
1109943635 13:69404518-69404540 GTGGGGAGCCAGAAAGAGGATGG - Intergenic
1110003708 13:70238612-70238634 ATGAGGAGCTGGAAAGGGGATGG - Intergenic
1110175785 13:72553948-72553970 AAGGGGAGCTGGAAGGGGGATGG + Intergenic
1110433900 13:75458209-75458231 ATGGGGAGCTGGAAAGAGGATGG + Intronic
1110484264 13:76019768-76019790 ATGGGGACCCAGAAGGGGCATGG + Intergenic
1110582882 13:77152721-77152743 AAGGGGAGCTAGAAAGGGCATGG - Intronic
1110714305 13:78683988-78684010 ATTGGGAGCTGGAAAGGGGATGG - Intergenic
1110835176 13:80074674-80074696 TGGAGGAGCCAGAAGGGAGATGG - Intergenic
1110964515 13:81676151-81676173 TGGGGAAGCCAGAAGGGGGATGG + Intergenic
1111073408 13:83200055-83200077 ATGGGGAGCTGGAAGGTGGATGG - Intergenic
1111097640 13:83535587-83535609 TGGGGGAGGCAGAAGGGAGATGG - Intergenic
1111184859 13:84720422-84720444 ATGGGGAGCCAGGAGGGAGATGG - Intergenic
1111206720 13:85020445-85020467 ATGGGTAGCCAGAAGGAGGAGGG - Intergenic
1111217225 13:85159776-85159798 TGGGGGAGCCAGAACGGAGATGG - Intergenic
1111262489 13:85760395-85760417 ATGGGGAGCCAGAAGGGGTATGG + Intergenic
1111292180 13:86185013-86185035 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1111292755 13:86188800-86188822 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1111343934 13:86924524-86924546 TGGGGGAGCCAGAAGGGAAATGG + Intergenic
1111406239 13:87810890-87810912 TGGGGCAGCCAGAAGGGAGATGG + Intergenic
1111413810 13:87912463-87912485 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1111451818 13:88428810-88428832 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1111453859 13:88453927-88453949 ATGGGGAGCTGGAAAGGGAATGG + Intergenic
1111584583 13:90268298-90268320 TGGGGAGGCCAGAAGGGGGATGG + Intergenic
1111878124 13:93921496-93921518 ATGGGGAGCTAGAAAGGGGATGG + Intronic
1112171493 13:96977180-96977202 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1112259765 13:97867666-97867688 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1112559610 13:100501371-100501393 ATGGAGACTCAGAAGGGTGACGG - Intronic
1112705275 13:102061073-102061095 ATGTGGAGCCAGCATGGGGATGG - Intronic
1112929240 13:104714023-104714045 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1113588316 13:111480780-111480802 ATGGGGAGCCAGAAGAAGGAGGG - Intergenic
1113697218 13:112354922-112354944 GAAGGGAGACAGAAGGGGGAGGG + Intergenic
1113789302 13:113019115-113019137 ATGGGGTGGGAGAAGGGGCAAGG - Intronic
1113967829 13:114164392-114164414 AAGGAGAGGCAGATGGGGGAAGG + Intergenic
1113973776 13:114211302-114211324 CTGGGGAGCATGAAGTGGGAGGG - Intergenic
1114049772 14:18913495-18913517 AGGAGGAGCCAGAAGAGGGGAGG + Intergenic
1114112789 14:19488436-19488458 AGGAGGAGCCAGAAGAGGGGAGG - Intergenic
1114178372 14:20343763-20343785 ATAGGGAGCTGGAAGGGGAAGGG - Intronic
1114231902 14:20790718-20790740 ATGGGGAGCCAGAAGAGGGAAGG - Intergenic
1114616484 14:24071450-24071472 ATTGGGAGGGAGAAGAGGGAAGG - Intronic
1114924899 14:27384133-27384155 GGGGGAAGCGAGAAGGGGGATGG + Intergenic
1114996939 14:28365485-28365507 ATGGGGAGCCAGAAAGGGGATGG - Intergenic
1115094540 14:29618971-29618993 ATGAGGAGGAGGAAGGGGGAGGG + Intronic
1115123985 14:29971189-29971211 TAGGGGAGCCAGAAGGGCGATGG + Intronic
1115159766 14:30380675-30380697 ACGGGCAGCGAGAAGGGGCAAGG + Intergenic
1115176595 14:30569179-30569201 CTGGGGAGAGAGAAGGGGTAGGG - Intronic
1115320625 14:32076699-32076721 AGGCGGAGGAAGAAGGGGGAGGG + Intronic
1115724511 14:36198502-36198524 AGGGGGAGTCGGGAGGGGGAGGG + Intergenic
1115899563 14:38129629-38129651 ATGGAGAGCTGGAAAGGGGATGG - Intergenic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1115977129 14:39009044-39009066 ATGAGCAGCAAGAAGGTGGAAGG + Intergenic
1115979138 14:39030262-39030284 ATGGGGAGCCAGAAGGGAGATGG + Intergenic
1116090067 14:40293733-40293755 ATTGGGAATCAGAAGGGGGATGG + Intergenic
1116121122 14:40723210-40723232 ATGGGGAGCTAAAAAGGGGATGG + Intergenic
1116345374 14:43786453-43786475 TGGGGAAGCCAGAAGGGAGATGG + Intergenic
1116523800 14:45880446-45880468 AAGGGGAACTGGAAGGGGGATGG - Intergenic
1116526352 14:45910588-45910610 AAGGGGAGCTGGAAAGGGGATGG - Intergenic
1117046235 14:51816366-51816388 ATGGGAAGCCGGAAGAGGGATGG + Intergenic
1117450564 14:55845706-55845728 AAGGGGAGCTGGAAGGGGGATGG + Intergenic
1117517965 14:56521377-56521399 TTGGAGAGTTAGAAGGGGGAGGG - Intronic
1117943997 14:60998483-60998505 ATGGGGAGCTGGAAAGGGGATGG - Intronic
1118163970 14:63317793-63317815 ATAGCCAGCCAGAAGGAGGAGGG + Exonic
1118474289 14:66102356-66102378 ATGGGGAGCTGGAAAGGTGATGG - Intergenic
1118667445 14:68086154-68086176 GGGGGAAGCCAGAAGGGGAATGG + Intronic
1118733403 14:68685030-68685052 ATGGTGAGCCAGCGGTGGGAAGG + Intronic
1118929344 14:70225642-70225664 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1119000062 14:70873572-70873594 ATGGGGAGCAAGAAAAAGGATGG - Intergenic
1119697666 14:76726530-76726552 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1119702250 14:76762946-76762968 ATGAGGAGCCAGAAGAGGAAGGG + Exonic
1119913314 14:78371372-78371394 AAGGGGAGGTGGAAGGGGGATGG - Intronic
1120128189 14:80772418-80772440 ATGGGGAGCTGGAGGGGGGATGG - Intronic
1120218376 14:81704993-81705015 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1120280463 14:82431747-82431769 ATGGGAAGGCAGAAGGGGGATGG + Intergenic
1120491152 14:85180126-85180148 AAGGGGAGCTAGAAAGGGGATGG - Intergenic
1121159668 14:91726059-91726081 ATGGCTACCTAGAAGGGGGATGG - Intronic
1121172709 14:91868157-91868179 ATGGGGAGCTGGACAGGGGATGG + Intergenic
1121666519 14:95676626-95676648 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
1121737468 14:96228463-96228485 GTGGGGAGCTGGAAAGGGGATGG + Intronic
1121904082 14:97723772-97723794 ATGGGGAGGGAGCAGGGGGTGGG - Intergenic
1122292411 14:100686868-100686890 CTGGAGAGGCAGGAGGGGGAGGG + Intergenic
1122322242 14:100862073-100862095 AGGGGGAGGGAGAAGGAGGAAGG - Intergenic
1122371153 14:101229776-101229798 TGGGGGAGCCAGAAGGGAGACGG + Intergenic
1122643326 14:103175353-103175375 AAGGGGAGCTGGAAAGGGGATGG - Intergenic
1123765152 15:23470839-23470861 AAGGGGAGCTGAAAGGGGGAGGG + Intergenic
1123809072 15:23905248-23905270 TGGGGGAGCCAGAAGGGTGATGG + Intergenic
1124034296 15:26039729-26039751 ATGGGAAGCCAGTACAGGGATGG + Intergenic
1124698373 15:31887670-31887692 ATGAGTAGACAGAAGGGGGATGG + Intergenic
1125446899 15:39767795-39767817 ATGGGGAGCTGGAACGGGGATGG - Intronic
1125883139 15:43210300-43210322 CTGGGGAACCAGAATGGGGCAGG - Intronic
1126227615 15:46289700-46289722 ATAGGGACCCAGCAGGGGAAAGG + Intergenic
1126228298 15:46296475-46296497 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1126322929 15:47444986-47445008 ATGGGGAGCTGGAAGGGGGATGG + Intronic
1126386567 15:48099579-48099601 ATGGGTAGGCAGAAGGAGAAGGG - Intergenic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1127027633 15:54824997-54825019 ATGGGGAGCTAGAAGGGGGATGG + Intergenic
1127725531 15:61745597-61745619 AGTGGGAGCCAGGAGGGAGAAGG - Intergenic
1127819581 15:62643313-62643335 ATGGGGAGCCAGAAGTGAGAAGG + Intronic
1127831341 15:62754119-62754141 ATGGGGTGCCAGAAGGCAAAAGG + Intronic
1127980764 15:64033264-64033286 AGGGGGAGGGGGAAGGGGGAAGG + Intronic
1128046062 15:64618608-64618630 TTGGGGAGCCAGAAGGGAGATGG + Intronic
1128315621 15:66657480-66657502 AGGGGGAGCCTGAAGAGGAAGGG - Intronic
1128338411 15:66803143-66803165 ATGGGGAGGCAGGGGGAGGAGGG - Intergenic
1128352630 15:66901240-66901262 CTGGGGAACCAGAAGAGGCAGGG + Intergenic
1128563413 15:68683249-68683271 GTGGGGAGCCTGAAGGACGAAGG + Intronic
1128591129 15:68898427-68898449 ATGGAGAGAGAGAAGGGGCAAGG - Intronic
1129255429 15:74331453-74331475 ATGGGGCGCCTGAATGAGGAGGG - Intronic
1129273154 15:74429879-74429901 AGGAGGAGCCAGCTGGGGGAGGG - Intronic
1129684172 15:77675883-77675905 TTGGGGAGCCAGAGTGGGGATGG - Intronic
1130073751 15:80671052-80671074 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1130430439 15:83842031-83842053 ATGGGGAGGCAGAAGGGGGATGG - Intronic
1130430447 15:83842050-83842072 ATGGGAAGGCAGAAGGGGGATGG - Intronic
1130430479 15:83842219-83842241 ATGAGGAGGCAGAAGGGGGATGG + Intronic
1130550300 15:84886371-84886393 ATGGGAAGGAAGGAGGGGGAGGG + Intronic
1130559209 15:84945398-84945420 TGGGGGAGCAGGAAGGGGGATGG - Exonic
1130682706 15:86010491-86010513 TGGGGGAGCCAGAAGAGAGATGG + Intergenic
1130803432 15:87291956-87291978 ATGGGGAGCTGGACAGGGGATGG + Intergenic
1130927346 15:88395688-88395710 ATAGGGAGTTAGAAGGGGGATGG + Intergenic
1131014142 15:89043472-89043494 AAGGAGAGGAAGAAGGGGGAGGG + Intergenic
1131254705 15:90854441-90854463 TTGGGAAGCCAGAATGGGCACGG + Intergenic
1131442683 15:92470858-92470880 ACAGGGAGCCAGAGGGAGGAGGG - Intergenic
1131557746 15:93414248-93414270 ATGGGGGGCCAGAAGGGGGACGG + Intergenic
1131646234 15:94348359-94348381 AGGGAGAGAGAGAAGGGGGATGG - Intronic
1131679377 15:94705626-94705648 AGGGAGAGAGAGAAGGGGGAGGG - Intergenic
1131709515 15:95037817-95037839 ATGGGGAACTGGAAAGGGGATGG - Intergenic
1133325752 16:4941178-4941200 ATGGGGAACGAGAAAGGAGAGGG - Intronic
1133354139 16:5123625-5123647 TGGGGGAGCCAGAAGGAAGATGG + Intergenic
1133392753 16:5422766-5422788 ATGGAGAGGGAGAAGGGAGAGGG + Intergenic
1133493901 16:6297878-6297900 ATGGGGAGCTGGAAAGGGGATGG - Intronic
1133696258 16:8265838-8265860 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1133816786 16:9203712-9203734 ATGAGGAGCTGGAAAGGGGATGG - Intergenic
1134346652 16:13397930-13397952 GCGGGGAGCCAGAAGGGAGATGG + Intergenic
1134347975 16:13409216-13409238 ATGGGGAACTGGAAGGGGGATGG - Intergenic
1134449404 16:14354232-14354254 AGGGGGAGGGGGAAGGGGGAAGG + Intergenic
1134588637 16:15434474-15434496 ACGGGTACCCAGAAGGGGCAGGG - Exonic
1134602330 16:15543118-15543140 AAGGGGAGCTGGAAAGGGGATGG + Intronic
1134747348 16:16598543-16598565 TTGGGGAGTCAGAAGCAGGAAGG + Intergenic
1134770605 16:16806050-16806072 AAGGGGAAGGAGAAGGGGGAAGG - Intergenic
1134873680 16:17676191-17676213 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1134993654 16:18722497-18722519 ATGGGGAGGGGGAGGGGGGAGGG + Intergenic
1134998123 16:18755115-18755137 TTGGGGAGTCAGAAGCAGGAAGG - Intergenic
1135352196 16:21738515-21738537 ATGGGGAGCTAGAAAGGGGATGG + Intronic
1135450686 16:22554637-22554659 ATGGGGAGCTAGAAAGGGGATGG + Intergenic
1135660177 16:24289606-24289628 GTAGGGAGCTAGAATGGGGATGG - Intronic
1135672511 16:24387296-24387318 ATGGGGAGTTGGAAAGGGGATGG + Intergenic
1135674848 16:24406635-24406657 ATGGGGAATTAGAAAGGGGATGG - Intergenic
1135939718 16:26810482-26810504 ATGAGGAGGCATAAGGGGGATGG + Intergenic
1136547737 16:30965134-30965156 CTGGGGAGCCAGAGCGGGCAGGG - Exonic
1137563897 16:49521558-49521580 ATGGGGAGACAGCAGTGGCATGG + Intronic
1137579060 16:49622348-49622370 GTGGGGAGTGAGAATGGGGAGGG - Intronic
1137853828 16:51773402-51773424 CGGGGGAGCAAGAAGGGAGATGG - Intergenic
1137908446 16:52350916-52350938 AAGGGAAGGCAGAATGGGGAGGG - Intergenic
1137964153 16:52914305-52914327 ATAGGGAGCTGGATGGGGGATGG - Intergenic
1138128333 16:54456984-54457006 TGGGGGAGCCAGAAGGGAGGTGG + Intergenic
1138135610 16:54518916-54518938 ATGGGGAGCCATTAGAAGGAAGG - Intergenic
1138462001 16:57154663-57154685 ATGGGGAAACTGAAGGAGGAAGG + Intronic
1138527564 16:57617884-57617906 TTGGGGTACCAGAAGGGAGAAGG - Intronic
1138628827 16:58277017-58277039 ATGGGGTGACAGGAGTGGGATGG + Intronic
1138706935 16:58924788-58924810 TTGGGGAGGCAGAAGTGGGCTGG - Intergenic
1139170879 16:64628016-64628038 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1139284455 16:65798071-65798093 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1139328051 16:66167103-66167125 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1139800963 16:69522291-69522313 ATACGGGGCCAGATGGGGGAAGG + Intergenic
1140257382 16:73348973-73348995 ATTTGGAGCAAGAATGGGGATGG + Intergenic
1140338912 16:74138173-74138195 ATGAGGAGCCAGTTGGGGGCTGG + Intergenic
1140339112 16:74139790-74139812 ATGGGGAGCTAGAAGGGGGATGG + Intergenic
1140461749 16:75145729-75145751 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1140564604 16:76026997-76027019 ATGGGGAGCTAGAAAGGGAATGG - Intergenic
1140748141 16:77999146-77999168 ATGGGCAGCCAGAAGGGGGATGG + Intergenic
1141252193 16:82368903-82368925 ATGGGGAGAGAGAGTGGGGAGGG + Intergenic
1141858505 16:86701053-86701075 ATGGGGGGCGGGAAGGGGAAGGG - Intergenic
1141982741 16:87560457-87560479 ATGGGGAGTGAGAAGGGGGCAGG + Intergenic
1142034554 16:87855269-87855291 ATGGGGAGGCACAAGGGGGTGGG - Intronic
1142300954 16:89257507-89257529 TGGGGGAGCCGGAAGGGAGACGG + Intergenic
1142301756 16:89262718-89262740 AAGGGGAGCTGGAAAGGGGATGG + Intergenic
1142641718 17:1288894-1288916 ATGGGGAGTCTGGTGGGGGATGG - Intronic
1142641736 17:1288931-1288953 ATGGGGAGTCCGGTGGGGGATGG - Intronic
1142641745 17:1288950-1288972 ATGGGGAGTCCGGTGGGGGATGG - Intronic
1142641764 17:1288987-1289009 ATGGGGAACCCGGTGGGGGATGG - Intronic
1142641797 17:1289060-1289082 ATGGGGAGTCTGGTGGGGGATGG - Intronic
1142641815 17:1289097-1289119 ATGGGGAGTCCGGTGGGGGATGG - Intronic
1142641824 17:1289116-1289138 ATGGGGAGTCCGGTGGGGGATGG - Intronic
1142641925 17:1289353-1289375 ATGGGGAACCTGGTGGGGGATGG - Intronic
1142725529 17:1810910-1810932 GTTGGGAGCCAGAAGGGAGATGG - Intronic
1143137488 17:4719971-4719993 ATGGAGAGCCAGACGGTGCAAGG + Intronic
1143465534 17:7133956-7133978 TGGGGTGGCCAGAAGGGGGATGG + Intergenic
1144212328 17:13025972-13025994 ATGGGGAGACAGAAAAGGGGAGG - Intergenic
1144300862 17:13922207-13922229 ATGGAAAGCCAGAAGGGGGATGG - Intergenic
1144302859 17:13939090-13939112 ATGGGGAGCCAGAAAGGGGATGG - Intergenic
1144320844 17:14117926-14117948 ATGGGGAGCCAGAAGGGGGATGG + Intronic
1144888168 17:18477853-18477875 GTGGGGAGGCAGAATGGGGAGGG + Intronic
1145144038 17:20466450-20466472 GTGGGGAGACAGAATGGGGAGGG - Intronic
1145289171 17:21529622-21529644 ATGGGGAGCTGGAAGTGGGGAGG - Exonic
1145353934 17:22119148-22119170 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1145377908 17:22368520-22368542 TTTGGGAGCCTGAAGTGGGAGGG + Intergenic
1146097659 17:29947401-29947423 ATGGAGACTCAGAAGTGGGAGGG + Intronic
1146297955 17:31665054-31665076 ATGAGGTGGGAGAAGGGGGAAGG - Intergenic
1146404216 17:32523242-32523264 ATGGGAAGGCAGGTGGGGGAGGG + Intronic
1146422215 17:32698289-32698311 AGGGGGAGGGAGAGGGGGGAAGG - Intronic
1146573092 17:33969519-33969541 CTGGGGAACAAGAAAGGGGAAGG + Intronic
1146614567 17:34344618-34344640 TTGGAGATTCAGAAGGGGGAAGG + Intergenic
1146809580 17:35892466-35892488 AAGGACAGCCAGAAGGGAGAAGG - Intergenic
1146824667 17:36012199-36012221 ATGTGGAGCTGGAAAGGGGATGG - Intergenic
1147533092 17:41298589-41298611 CGGGGGAGCCAGAAGGGGGATGG - Intergenic
1147562992 17:41520352-41520374 GTGGGGATCCAGGAGGGGGCAGG - Exonic
1147580657 17:41625557-41625579 TTGGGGAGCCTGGAGTGGGAAGG - Intergenic
1147646244 17:42035897-42035919 GTGGGGGGCCAGTAGGGGGCAGG + Intronic
1147906343 17:43825573-43825595 ATGGGGTGGCAGCAGGAGGAGGG - Intronic
1147927379 17:43954004-43954026 AGGGGGAGCCAGCAGGGGGTGGG + Intronic
1148044420 17:44733947-44733969 ATGTGTAGCCAGAAGGTGGCAGG + Intronic
1148062729 17:44847845-44847867 ATAGGGATGCAGATGGGGGAAGG + Intronic
1148084506 17:44985807-44985829 TGGGGGAGCCAGAAGGGGGATGG - Intergenic
1148161215 17:45451265-45451287 ATGGGCAGCCAGCAGGGGGCAGG + Intronic
1148166871 17:45490169-45490191 TTGGGGAGCTAGACGGGGGATGG + Intronic
1148219074 17:45849650-45849672 CTAGGGAACCAGCAGGGGGAGGG - Intergenic
1148387015 17:47241484-47241506 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1148394194 17:47295379-47295401 GAGGGGAGCCAGAAAAGGGAGGG - Intronic
1148537768 17:48455162-48455184 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
1148892972 17:50820974-50820996 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1149090246 17:52769396-52769418 ATGAAGACCCAGAAGGGAGAGGG + Intergenic
1149102947 17:52928009-52928031 ATGGGGAGATGGAAGGGGGTTGG + Intergenic
1149132174 17:53316122-53316144 CAGGGGAGTCAGAAGGGAGATGG + Intergenic
1149217096 17:54370216-54370238 CTGGGGAGTTAGAAGGGGGATGG + Intergenic
1149275350 17:55027400-55027422 TTGGAGACTCAGAAGGGGGATGG + Intronic
1149654706 17:58304152-58304174 AAGGGGAGCAGGGAGGGGGAGGG + Intronic
1149882608 17:60308059-60308081 ACGGTGAGCCAGAAGGGGATTGG - Intronic
1150120725 17:62599512-62599534 ATGGGAAGGCAGAAATGGGAGGG + Intronic
1150125188 17:62630571-62630593 CTGGGAGGCCAGAATGGGGATGG + Intronic
1150392450 17:64797911-64797933 ATGGGTAGCCAGCAGGGGGCAGG + Intergenic
1150854722 17:68741035-68741057 ATAGGGAGCTGGAAGGGGGATGG - Intergenic
1150931524 17:69590241-69590263 ATGGGGAGCTGGGAAGGGGATGG + Intergenic
1150999025 17:70352137-70352159 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1151398883 17:73842882-73842904 ATGGGCAGCCAGAGGGGAGCGGG - Intergenic
1151464605 17:74276422-74276444 ATGGGGTGACAGAGCGGGGACGG - Intronic
1151597402 17:75087004-75087026 ATGTGGAGTGAGAAGAGGGAGGG + Intergenic
1151765393 17:76131017-76131039 ATGGGGAGAAAGAAAGGAGAGGG - Intergenic
1152025415 17:77805728-77805750 AGGGGATGCCAGATGGGGGAGGG + Intergenic
1152025423 17:77805747-77805769 AGGGGACGCCAGATGGGGGAGGG + Intergenic
1152302025 17:79500621-79500643 ATGGGGAAATTGAAGGGGGAAGG - Intronic
1152335237 17:79696870-79696892 TGGCGGAGCCAGAAGGGAGATGG - Intergenic
1152464637 17:80458853-80458875 ACTGGGAGCCAGCAGGGGAACGG - Intergenic
1152526189 17:80889513-80889535 CTGGGGAGCCCTCAGGGGGAAGG + Intronic
1152643250 17:81457830-81457852 CTGGGTAACCAGGAGGGGGAGGG + Intronic
1152643321 17:81458010-81458032 CTGGGTAACCAGGAGGGGGAGGG + Intronic
1153351367 18:4084042-4084064 GATGGGAGCCAGAAGCGGGATGG + Intronic
1153681457 18:7504823-7504845 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1153703212 18:7717415-7717437 AAGGGGAGACAAAAAGGGGATGG - Intronic
1153773756 18:8435286-8435308 GATGGGAGCCAGAAGGGAGATGG - Intergenic
1153841028 18:9008008-9008030 ATGGGGTGGGGGAAGGGGGAAGG + Intergenic
1153842753 18:9021945-9021967 CTGGGGAGGCTGAAGTGGGAGGG - Intergenic
1153990481 18:10394731-10394753 TGGGGGAGACAGAAGGGAGATGG + Intergenic
1154155925 18:11944057-11944079 ATGGGGAGCTGGAAGGGAGATGG + Intergenic
1154175322 18:12083788-12083810 ATGGGGTGCGGGGAGGGGGACGG + Intergenic
1154280233 18:12996027-12996049 ATGGGGAACCAGTGGAGGGAGGG + Intronic
1154388619 18:13917607-13917629 ATGGGGAAACAGAAGGGGACAGG + Intergenic
1155315134 18:24563740-24563762 ATGGAGACTCAGAAGGGGGACGG - Intergenic
1155374478 18:25140646-25140668 ATGGGGAGACAGAGGGGAGAAGG + Intronic
1155683705 18:28520914-28520936 ATGGGGAGCTGGAAAGAGGATGG - Intergenic
1155700212 18:28734098-28734120 ATGGGGAGCCATCAGGCTGATGG + Intergenic
1155703495 18:28778985-28779007 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1155746104 18:29357944-29357966 GTTGGGAGACAGAAGGAGGATGG + Intergenic
1155771342 18:29704342-29704364 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1155778133 18:29794218-29794240 TGGGAGAGCCAGAAGGGAGATGG + Intergenic
1155822119 18:30391101-30391123 ATGGGGAACTAGAAGGCGGATGG - Intergenic
1156311529 18:35926830-35926852 ATGGGGAGCTGGAAAGGGAATGG - Intergenic
1156439266 18:37167445-37167467 ATGGGGTGTCAGAAGGGGGATGG + Intronic
1156514932 18:37671387-37671409 TGGGGAGGCCAGAAGGGGGATGG - Intergenic
1156551915 18:38027422-38027444 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1156691081 18:39707959-39707981 TGGAGGAGCCAGAAGGGAGATGG + Intergenic
1157002369 18:43542317-43542339 GATGGGAGCCAGAAAGGGGATGG + Intergenic
1157014792 18:43699007-43699029 ACGGGGAGCTAGAAAGGCGATGG + Intergenic
1157410400 18:47458440-47458462 AAGGGGAGACAGAAGAGAGAGGG + Intergenic
1157534976 18:48451469-48451491 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1157679540 18:49593694-49593716 ATGGAAAGCCAGAAAAGGGAAGG + Exonic
1157762840 18:50276795-50276817 AAGGTGAGCCAGATGGGTGAGGG - Intronic
1157858914 18:51124003-51124025 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1157859228 18:51125759-51125781 ATGGGGAGCTAGAAAGAGAATGG + Intergenic
1157914857 18:51654946-51654968 ATGGGGAGGCGGAGTGGGGAAGG - Intergenic
1158015220 18:52775527-52775549 TGGGGGAGCCAGAAGGGAGATGG + Intronic
1158057902 18:53303937-53303959 ATGGGAAGCTAGAAAGGGGGTGG + Intronic
1158187861 18:54791942-54791964 ATGGAGAGCCAGAAGGGAGATGG - Intronic
1158369557 18:56784434-56784456 ATGGAGACTCAGAAGGGGAAGGG - Intronic
1158423107 18:57313436-57313458 AAGGGGAGGGGGAAGGGGGAAGG + Intergenic
1159242944 18:65766696-65766718 ATGGGGAGAAGGAAGGGGGGAGG + Intronic
1159328050 18:66949495-66949517 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1159417604 18:68173259-68173281 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1159726578 18:71967858-71967880 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1159923387 18:74246717-74246739 ATGGGGAGATAGCAGGAGGATGG - Intergenic
1159923428 18:74246841-74246863 ATGGGGAGATAGTGGGGGGATGG - Intergenic
1160149454 18:76388113-76388135 ATGAGGAGCTGGAAAGGGGATGG - Intronic
1160342657 18:78102597-78102619 TTGTGGAGCGTGAAGGGGGAGGG + Intergenic
1160623526 18:80187609-80187631 CAGGGGAGCCAGGAGGTGGATGG - Intronic
1160743566 19:699292-699314 ATGGGGACACAGTAGGGAGAGGG + Intergenic
1160869995 19:1273338-1273360 TAGGGGAGCCAGGCGGGGGACGG + Intronic
1161281442 19:3447817-3447839 AGGGGGTGCCTGGAGGGGGAGGG + Intronic
1161324329 19:3656131-3656153 ATGGGGAGCCAGGCAGGGGCCGG + Intronic
1161330290 19:3683710-3683732 AGGAGGAGCCAGGCGGGGGAAGG + Intronic
1161821620 19:6533742-6533764 AGGGGGAGGGGGAAGGGGGAAGG - Intronic
1162028618 19:7907886-7907908 CTCGGGAGCCAGAAGGGGACTGG + Intronic
1162178182 19:8847249-8847271 ATGGGGAGCTAGAAGGGGGATGG + Intergenic
1162639893 19:11999998-12000020 TAGGGGAGCCAGAAGCGAGATGG - Intergenic
1162973199 19:14193477-14193499 CTGGGAAGGCTGAAGGGGGAGGG + Intronic
1163272525 19:16262757-16262779 CTGGGGAGTCAGAAGTAGGATGG - Intergenic
1163579505 19:18130005-18130027 TTTGGGAGCCCGAAGTGGGAGGG + Intronic
1163616668 19:18333163-18333185 CTAGGGAGCCAGGTGGGGGAAGG - Intergenic
1163617087 19:18335764-18335786 TGGGGGAGCGAGAAGGGAGATGG - Intergenic
1163698052 19:18773942-18773964 ATGGGGAGCTCCAAGGGAGAGGG + Intronic
1163736424 19:18984077-18984099 GTGGAGAGCCAGAAAGGAGAGGG + Intergenic
1163837277 19:19582540-19582562 ATGGGGGGCCCAAAGGGGGTTGG - Intronic
1163879053 19:19901636-19901658 ATGGGGAAAAAGAAGGGGTAGGG - Intronic
1164443850 19:28300544-28300566 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1164659487 19:29949922-29949944 GTGGGGAGACGGGAGGGGGAGGG + Intronic
1164683165 19:30149508-30149530 ATGTGGGGCCAGAAGGGGTCAGG + Intergenic
1164713791 19:30377044-30377066 ATGGGGACCCTGGAAGGGGATGG + Intronic
1164922742 19:32101799-32101821 ATGGAGACTCAGAAGGGGGTGGG - Intergenic
1165295830 19:34925372-34925394 TGGGGGAGCCAGAAGGGAAATGG + Intergenic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1166326536 19:42054300-42054322 ATGGTGAGCCCGAGCGGGGATGG - Exonic
1166356214 19:42229089-42229111 ATGGGGTGGTAGAAGGGTGAGGG + Intergenic
1166621610 19:44306272-44306294 AGGGGGAGCCAGAAGGGAGATGG + Intergenic
1166803983 19:45474003-45474025 GAGGGGAGGAAGAAGGGGGATGG - Exonic
1166864970 19:45830310-45830332 CTGGAGAGGCAGCAGGGGGATGG - Intronic
1167212642 19:48143018-48143040 ATGGGGACAGAGAAGGGGGCTGG + Intronic
1167300789 19:48676320-48676342 ATGGGGAGCCGGGAGGGGTGAGG + Intergenic
1167445558 19:49535096-49535118 CTGGGGGCCCAGGAGGGGGAGGG - Intronic
1167552285 19:50169485-50169507 ACAGAGACCCAGAAGGGGGAGGG - Intergenic
1167579069 19:50331484-50331506 AAGGGGAAGAAGAAGGGGGAGGG - Intronic
1167691752 19:50989258-50989280 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1167758129 19:51426239-51426261 CAGGGGAGCCATAATGGGGATGG - Intergenic
1168186883 19:54705704-54705726 ATGGGGAGCCACAGGTGGAAAGG + Intergenic
1168290102 19:55353399-55353421 ATGGAGAGGGAGAAGGGGGACGG + Intronic
1168309098 19:55451836-55451858 ATGTGGAGACAGAGGGGTGACGG - Intergenic
1168388535 19:55986915-55986937 TTGAGCAGCCAGAAGGGAGAGGG - Intronic
1168433858 19:56302524-56302546 ACGGGGAGGAAGAAGAGGGAGGG - Intronic
1168538654 19:57192229-57192251 ATTGGGGGCCTGAGGGGGGAAGG + Intronic
1168709398 19:58490051-58490073 CTGGGGAGGCTGAAGTGGGAGGG - Intronic
1202645244 1_KI270706v1_random:133234-133256 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
925026047 2:608125-608147 TTGAGGAGCCAGAGAGGGGAAGG - Intergenic
925092509 2:1166946-1166968 ATGGAGAGCCAGAAGGGGCATGG - Intronic
925424759 2:3739637-3739659 TGGCGGAGCCAGAAGGGAGACGG - Intronic
925434772 2:3827294-3827316 AAGGGGAGGCAGCAGGGGCAGGG + Intronic
925637112 2:5951165-5951187 CTGGGGAGAGAGAAGGAGGAAGG - Intergenic
925706324 2:6687083-6687105 ATGGGGAGCTGGAAAGGAGATGG + Intergenic
925806759 2:7658566-7658588 TGGCGGAGCCAGAAGGGAGATGG + Intergenic
925839810 2:7980506-7980528 TGGGGGAGGCAGAAGGGAGATGG - Intergenic
925993915 2:9276308-9276330 CTGGGAAGACAGCAGGGGGAGGG + Intronic
926139263 2:10358738-10358760 TGGGGGAGCCAGAAGGGAGATGG - Intronic
926173709 2:10570278-10570300 ATGGTGAGACAGGAGGAGGAAGG + Intergenic
926464846 2:13175552-13175574 ATGGGGAGCTAGAAAGGGGATGG + Intergenic
926906942 2:17814827-17814849 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
927584014 2:24282372-24282394 TGGGGGAGCCAGAAGGGAGACGG - Intronic
927747814 2:25638208-25638230 ATGGGATGGCAGGAGGGGGAGGG + Intronic
927925467 2:27010369-27010391 ATATGGAGTCTGAAGGGGGATGG + Intronic
927937746 2:27085085-27085107 CTGGGGATCCAGCAGGGGAAGGG + Intronic
928017827 2:27674945-27674967 TTTGGGAGGCTGAAGGGGGATGG - Intronic
928158232 2:28895383-28895405 AAGGGGGGGCAGGAGGGGGAAGG - Intronic
928308829 2:30193469-30193491 CTAGGGAGGCAGCAGGGGGAGGG - Intergenic
928494026 2:31813456-31813478 ATGGGGAGCTAGAAAGTGGATGG + Intergenic
928537921 2:32258103-32258125 TGGGGTAGCCAGAAGGGAGATGG + Intronic
928589923 2:32803519-32803541 CTGGGGAGACAGAAGTGGGTTGG - Intronic
928664492 2:33537119-33537141 ATGGGGAGCTGGAAAGGGGATGG + Intronic
928819341 2:35342186-35342208 ATGGGGAGCCAGAAGGGAGATGG - Intergenic
928869662 2:35961502-35961524 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
928924968 2:36568163-36568185 AGGGAGAGACAGAAGGGGTAGGG + Intronic
929107383 2:38377753-38377775 ATGGGGAGAGAGGAGGGGAATGG - Intergenic
929222457 2:39478492-39478514 ATGGGGAGGAAGCAGGGGTATGG + Intergenic
929628516 2:43434683-43434705 TGGGGGAACCAGAAGGGAGATGG - Intronic
929886022 2:45879300-45879322 AAGGGGAGCGGGAAAGGGGATGG - Intronic
930297943 2:49578887-49578909 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
930320106 2:49843728-49843750 AAGGGGAGCTGGAAAGGGGATGG + Intergenic
930533201 2:52615461-52615483 ATGGGAAGCAGGAAAGGGGATGG - Intergenic
930717799 2:54609076-54609098 AAGGGGAGGCAGAAGAGGCAGGG + Intronic
930752261 2:54945224-54945246 GAGGGGAGAGAGAAGGGGGAGGG - Intronic
930752270 2:54945254-54945276 GAGGGGAGAGAGAAGGGGGAGGG - Intronic
931224832 2:60320737-60320759 TGGGGGAGCCAGCAAGGGGAGGG - Intergenic
931369239 2:61646865-61646887 ATTGGTTGCCAGAAGGAGGAGGG + Intergenic
931470164 2:62531652-62531674 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
931855706 2:66299737-66299759 GAGGGGAGCCAGCATGGGGAGGG + Intergenic
932427139 2:71645285-71645307 TTGGGGAGCCAGAAGGGAGATGG + Intronic
932824065 2:74924475-74924497 ATGGGGTGGCAGAACTGGGAAGG + Intergenic
932827269 2:74953025-74953047 ATGGGGAGTTGGAAAGGGGATGG + Intergenic
932830022 2:74980325-74980347 ATGCTGAGGCAGAAGGGGCATGG + Intergenic
932893065 2:75612621-75612643 ATGGGGAGCCAGATGGGTGAGGG - Intergenic
933140894 2:78792221-78792243 ATGGGGAGCCAGATGAGGGATGG + Intergenic
933141438 2:78795743-78795765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
933158849 2:79002416-79002438 AGAGAGAGCCAGTAGGGGGAAGG + Intergenic
933250632 2:80024964-80024986 AAGGGGAGCTGGAAGGGGCAAGG + Intronic
933315222 2:80706815-80706837 CGGGGGAGCCAGAAGGAAGATGG - Intergenic
933398831 2:81765653-81765675 TGGGGGAGCCAGGAGGGAGATGG - Intergenic
933425949 2:82112540-82112562 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
933437246 2:82263275-82263297 ATGAGGAGCTGGAAGGGGCATGG + Intergenic
933438728 2:82282598-82282620 TAGGGAGGCCAGAAGGGGGATGG + Intergenic
933947466 2:87299002-87299024 AAGGAGAGACAGAAGGGGCATGG - Intergenic
934121425 2:88843923-88843945 ATAGGGAGGCAGATGAGGGAAGG - Intergenic
934507649 2:94906820-94906842 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
934583599 2:95468131-95468153 ATGGTGTGCCAGAAGGGGGATGG + Intergenic
934595853 2:95608583-95608605 ATGGTGTGCCAGAAGGGGGATGG - Intergenic
934738493 2:96702534-96702556 ATGGGGCTCCAGCTGGGGGATGG + Intergenic
934785222 2:97000223-97000245 GTGGGGAGGCTGAAGTGGGAGGG - Intronic
934786921 2:97016905-97016927 ATGGTGTGCCAGAAGGGGGATGG + Intronic
934791760 2:97068090-97068112 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
934858402 2:97743216-97743238 GTGGAGAGCCAGAGGTGGGAGGG - Intergenic
934902554 2:98172244-98172266 TAGGGGAGCTAGAAGGGTGATGG + Intronic
934913338 2:98278544-98278566 ATGGAGAGCTAGAAAGGGGATGG + Intronic
934957063 2:98631674-98631696 TGGGGGAGCCAGAAGGGAGATGG - Intronic
935138819 2:100333142-100333164 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
935175903 2:100648524-100648546 AAGGGGAGCTGGAAAGGGGATGG - Intergenic
935206485 2:100901097-100901119 ATGGGGAGGTAGAAGGAGGGAGG - Intronic
935227058 2:101061821-101061843 ATGGGGAGCCTGAAGGGCCAGGG - Intronic
935332241 2:101985712-101985734 AGGGGCAGCCAGAAGGCAGATGG + Intergenic
935543659 2:104378278-104378300 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
935555843 2:104508744-104508766 ATGGGGACCCACATGGAGGAAGG + Intergenic
935663998 2:105494506-105494528 TGGGGGAGCCAGAAGGGTGATGG + Intergenic
935876725 2:107515371-107515393 ATGGGGAGCCATTAGGGACATGG + Intergenic
935882214 2:107575933-107575955 TGGGGAAGCCAGAAGGGAGATGG - Intergenic
935958172 2:108399242-108399264 ATGGGGAGGTAGCAAGGGGATGG - Intergenic
936267074 2:111018742-111018764 ATGGGGAGCGAGCTGAGGGAGGG + Intronic
936332729 2:111562565-111562587 AAGGAGAGACAGAAGGGGCATGG + Intergenic
936580027 2:113691493-113691515 ATGGAGACTCAGAAGGGGGAGGG - Intergenic
936647544 2:114389053-114389075 ATGGGGAGCTGGAAATGGGATGG - Intergenic
936657621 2:114506337-114506359 AAGGGGAGCTGGAAAGGGGATGG - Intronic
936835394 2:116703601-116703623 ATGGGGAGTGAGTAGAGGGAAGG - Intergenic
936885889 2:117309728-117309750 ATGGGCAGCCTGAGAGGGGAGGG - Intergenic
937316181 2:120933390-120933412 ATGGGGAGACAAATGGGGCAGGG + Intronic
937508898 2:122570722-122570744 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
937509998 2:122584425-122584447 ATGGGGTGGGGGAAGGGGGAGGG + Intergenic
937743712 2:125386501-125386523 ATGGGGAACCAGAAGGGGGAAGG + Intergenic
937820760 2:126308084-126308106 CGGGGGAGCCAGAAGGGAGATGG + Intergenic
937917202 2:127105208-127105230 TTGGGGAGCCAGGAAGGGGTGGG + Intronic
937942947 2:127302400-127302422 ATGGGAAGGAAGAAGGGGAAAGG - Exonic
937955096 2:127417670-127417692 CCGGGGTGCCAGAAGGGAGAAGG - Intergenic
938030239 2:127986008-127986030 GGGGGAAGCCAGAAGGGAGATGG - Intronic
938288447 2:130137059-130137081 AGGGGGAGTCAGAAGAGGGGAGG - Intergenic
938305169 2:130248310-130248332 ATGAGGCCCCAGAAGGGAGAAGG - Intergenic
938364392 2:130723338-130723360 ATGGGGTGGGAGAAGGGGGGAGG - Intergenic
938427137 2:131201831-131201853 AGGGGGAGTCAGAAGAGGGGAGG + Intronic
938448847 2:131398897-131398919 ATGAGGCCCCAGAAGGGAGAAGG + Intergenic
938549962 2:132370814-132370836 ATGGGGTGCTGGAAGGGAGATGG + Intergenic
938699526 2:133863577-133863599 ATGGGGAGCTGCAAAGGGGATGG + Intergenic
938779825 2:134575091-134575113 ATGGGAGGCCAGAGGGAGGAAGG + Intronic
938897401 2:135765817-135765839 CTTGGGTGCCAGAAGGGGGCAGG - Intronic
939010102 2:136836561-136836583 ATGGGGATCTAGAAAGGTGATGG - Intronic
939245089 2:139613162-139613184 ATGGGGTGCTGGAAAGGGGATGG - Intergenic
939451164 2:142376416-142376438 ATGGGGAGCCAAAAGGTGGATGG - Intergenic
939553129 2:143640284-143640306 ATGGGGAATCAGAAGGAAGAGGG + Intronic
939649722 2:144745727-144745749 TGGGGGAGCCAGAAGTGAGATGG - Intergenic
939829376 2:147053937-147053959 ATGGGGAGCTGGAAGTGGGATGG - Intergenic
939870889 2:147524620-147524642 AAGGGTAGCTAGAAGGAGGAAGG + Intergenic
940327740 2:152443165-152443187 ATGGGGAACCAGATGGGTGGTGG + Intronic
940360491 2:152791111-152791133 TGGGGGAGCCAGAAGAGAGATGG - Intergenic
940369915 2:152889758-152889780 GTGGGGAGCGGGGAGGGGGAGGG - Intergenic
940404696 2:153287525-153287547 ATGGTGAGCCGGAAGAGGAATGG + Intergenic
940658698 2:156520057-156520079 ATGGGGAGCTGGAAAGGGGATGG + Intronic
940660014 2:156534120-156534142 ATGGGGAGCTAGAAAGGGGATGG + Intronic
941106840 2:161364080-161364102 TGGGGGAGCCAGAAGGGAGATGG + Intronic
941309619 2:163912599-163912621 ATGGGGAGCCAGAAGAGGGATGG - Intergenic
941629249 2:167865968-167865990 ATGGGGAGGAGGATGGGGGAGGG - Intergenic
941717529 2:168779713-168779735 ATGGGGAGTTGGAAAGGGGATGG - Intergenic
941880578 2:170476487-170476509 ATGGAGAGCTGGAATGGGGATGG + Intronic
941974398 2:171386998-171387020 TTGGGGAGTCAGAAGGGAGATGG - Intronic
941990567 2:171552421-171552443 ATGGGGAGACAGAAGAAGGGAGG - Intronic
942139603 2:172964774-172964796 ATGGGGTGAGAGAAGGGGGCAGG - Intronic
942431837 2:175920295-175920317 ATGGGGTGGGGGAAGGGGGAGGG + Intergenic
942983174 2:182106525-182106547 ATGGGGAGCCAGAAGTGGGATGG - Intronic
943453277 2:188072548-188072570 ATGGGGAGCCAGAAAGAGGTTGG - Intergenic
943521016 2:188949399-188949421 ATGAGGAGCTGGAAGTGGGAAGG - Intergenic
943749191 2:191494081-191494103 ATGGGGAGCTGGAAAGGAGATGG + Intergenic
943838878 2:192552264-192552286 TTGGGGAGCCAGAAGAGGGATGG + Intergenic
943943249 2:194025694-194025716 ATGGGGTGGGAGGAGGGGGAAGG + Intergenic
944024146 2:195143389-195143411 ATGGGGAGTTGGAAAGGGGATGG + Intergenic
944058688 2:195548699-195548721 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
944306873 2:198188880-198188902 TGGGGAAGCCAGAAGGGGGGTGG - Intronic
944529043 2:200649681-200649703 AGGAGGAGCCAGGAAGGGGAAGG - Intronic
944586640 2:201178869-201178891 AATGGGAGGCAGAAGGGGGCAGG + Intergenic
944728355 2:202495285-202495307 TGGGGGAACCAGAAGGGAGATGG + Intronic
944729009 2:202499413-202499435 GTGGGGATCCATAATGGGGATGG - Intronic
944845483 2:203663955-203663977 TTGGGGAGGCTGAAGGGGGCAGG - Intergenic
944962599 2:204892086-204892108 AGGGGGAGCCAGAGGGGACAAGG + Intronic
945047979 2:205798692-205798714 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
945762831 2:213935457-213935479 ATGGGAAGAAAGAAGGGGCAAGG - Intronic
946016309 2:216606822-216606844 AAGGGGGGCCAGGAGGGGGCCGG - Intergenic
946053205 2:216880819-216880841 GTGGGGAAGCAGAAGGGGGAGGG - Intergenic
946056768 2:216909778-216909800 ATGGGGAAACAGAAGGGAGATGG - Intergenic
946210469 2:218143535-218143557 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
946602755 2:221370211-221370233 ATTGGGAGGCTGAAGTGGGAGGG + Intergenic
946609397 2:221441440-221441462 ATGGGGAGCTGGAAAGGGGAAGG - Intronic
946719617 2:222590364-222590386 ATGGGGTGGGGGAAGGGGGAGGG + Intronic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
947708508 2:232295277-232295299 ATGGGGAGTGTGATGGGGGAAGG - Intronic
947808259 2:232983172-232983194 TTGGGGAGCCAGCAGTGGGGAGG + Intronic
948008258 2:234629063-234629085 ATGGGGAGCTGGGAGGGGGATGG - Intergenic
948302665 2:236919758-236919780 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
948326824 2:237128426-237128448 ATGGGGTGGCGGGAGGGGGAGGG + Intergenic
948525361 2:238567759-238567781 AGGGGAAGTCAAAAGGGGGATGG - Intergenic
948586107 2:239020764-239020786 AGAGGGAGGCAGGAGGGGGACGG - Intergenic
948787045 2:240358242-240358264 ATGGGGAACCAGCATGGGGCTGG + Intergenic
948948285 2:241232974-241232996 CTGGGGAGGAAGAAGGGGAAGGG + Intronic
949047325 2:241877911-241877933 TGGGGGGGCCGGAAGGGGGAAGG - Intergenic
1169178619 20:3542548-3542570 AAGGGGAGGTGGAAGGGGGAAGG - Intronic
1169291746 20:4359003-4359025 AGTGGGAGCCAGAAGGGGAGAGG + Intergenic
1169373018 20:5043179-5043201 CTGGGGAGCCAGAAGGAAGCTGG - Intergenic
1169440128 20:5626927-5626949 AAGGGGAGCCAGAAGGGGGATGG - Intergenic
1169612105 20:7392986-7393008 ATGGGGAGCCAGATAGGGCAAGG - Intergenic
1169634862 20:7678160-7678182 ATGGGGTGGGAGGAGGGGGAAGG + Intergenic
1170184763 20:13576192-13576214 ATTCCGAGACAGAAGGGGGAGGG + Intronic
1170270972 20:14527037-14527059 TGGGGGAGCCAGAAGGGAGATGG + Intronic
1170557787 20:17529428-17529450 ATTGGGAGACAGAGGTGGGAAGG - Intronic
1170834059 20:19868691-19868713 TTGGGGACCCAGAAAGGGGAAGG + Intergenic
1170984042 20:21242223-21242245 ATAGGGAGTCAGAAGTGGGAAGG + Intronic
1171211566 20:23321011-23321033 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1171316908 20:24203273-24203295 GTGTGGAGCCAGGAAGGGGAAGG - Intergenic
1171384211 20:24756762-24756784 TGGGGGAGCCACAAGGGAGACGG + Intergenic
1171564190 20:26163273-26163295 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1171895207 20:30752154-30752176 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1172015626 20:31870797-31870819 AGGCAGAGCCGGAAGGGGGACGG - Intronic
1172135081 20:32681339-32681361 AAAGGGAGCGAAAAGGGGGAGGG + Intergenic
1172232854 20:33348608-33348630 CTGAGGAGCCAGAAGGAGCAGGG + Intergenic
1172396202 20:34607511-34607533 ATGGAGAGCTGGAAAGGGGATGG - Intronic
1172408011 20:34703857-34703879 GAGGTGAGCCAGAGGGGGGAGGG + Intronic
1172409666 20:34711680-34711702 TGGGGGAGACAGAAGGGGCAGGG + Exonic
1172585177 20:36078166-36078188 TTGGGGAGCCAGAAGGGAAATGG + Intergenic
1172841483 20:37904855-37904877 ATGGTGAGGCAGAAGGGGGCGGG - Intronic
1172859160 20:38033802-38033824 CAGGGGTGCGAGAAGGGGGAGGG - Exonic
1173002048 20:39111647-39111669 AAGGGGAGGAGGAAGGGGGAGGG + Intergenic
1173059518 20:39648121-39648143 ATGGGAAGCTGGAAGGTGGAGGG + Intergenic
1173131946 20:40402194-40402216 ATGGGGAGTCAGAAGAAGTAAGG - Intergenic
1173144553 20:40513519-40513541 ATGGGGAGGCAGAGTGGGGCTGG - Intergenic
1173369928 20:42426417-42426439 ATGGGGAGGTGGAAAGGGGATGG - Intronic
1173389955 20:42623063-42623085 ATGGGGAGCTAGAGGGGGAATGG - Intronic
1173493859 20:43504907-43504929 ATGGGGAAACAGAAGGGGAATGG - Intergenic
1174021749 20:47535852-47535874 ATGGGGAGCCATAAGAGGGATGG + Intronic
1174028786 20:47603652-47603674 ATGAGGAGCTGGAAAGGGGATGG + Intronic
1174812387 20:53658066-53658088 ATGGGAAGAAAGAAGGGGGAAGG + Intergenic
1175451470 20:59072408-59072430 ACTGGGAGCCAGAAGAGGCAAGG + Intergenic
1175774147 20:61642307-61642329 ATGGGGAACCAGCAGGTGGATGG + Intronic
1175774159 20:61642344-61642366 ATGGGGAACCAGCAGGTGGGTGG + Intronic
1176071812 20:63230881-63230903 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1176239173 20:64067995-64068017 AAGGGGAGGCAGAGGAGGGAGGG - Intronic
1176257223 20:64158742-64158764 AGGTGGAGCAAGTAGGGGGAGGG - Intronic
1176606641 21:8839508-8839530 ATGGGAAGCTGGAAAGGGGATGG + Intergenic
1176980493 21:15375897-15375919 ATGGGGAGCTGGAAATGGGATGG - Intergenic
1176981013 21:15381046-15381068 ATGGGGAGCTGGAAAGGGAATGG - Intergenic
1176981525 21:15386790-15386812 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1177264469 21:18765040-18765062 TGGGGGAGCCAGAAGGAAGATGG - Intergenic
1177264483 21:18765115-18765137 TGGGGGAGCCAGAAGAGAGATGG - Intergenic
1177339526 21:19782149-19782171 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1177601295 21:23318254-23318276 TGAGGGAGCCAGAAGGGAGATGG + Intergenic
1177647443 21:23917696-23917718 ATGGGGAGCTGGAAGGGGGCTGG - Intergenic
1178087048 21:29122515-29122537 ATGGAGAGCTGGAAAGGGGATGG + Intronic
1178094292 21:29197488-29197510 ATGGGGAGCTGGGAGGAGGATGG - Intronic
1178195815 21:30344281-30344303 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1178199831 21:30390911-30390933 GTGGGGAGCTAGAAGGGGGATGG - Intronic
1178213738 21:30569208-30569230 ATGGGGAGCTGGAAGGTGGAGGG - Intergenic
1178384524 21:32138435-32138457 ATGGGGATCCAGAAGGGGGTTGG - Intergenic
1178422361 21:32452707-32452729 ATGGGGAGCCAGAAGGGGGATGG + Intronic
1178438671 21:32581278-32581300 TGGGGGAGCCAGAAGGGAGATGG - Intronic
1178917265 21:36713055-36713077 TTGGGGAGAGAGAATGGGGAGGG + Intronic
1178969678 21:37161613-37161635 GTGGGGAGCAGAAAGGGGGATGG + Intronic
1179007579 21:37529028-37529050 ATGGGGAGACAGCAGGGGAGGGG - Intergenic
1179024855 21:37671430-37671452 ATGAGCAGCCAGAAGGAAGAAGG - Intronic
1179095916 21:38314340-38314362 ATGGGGAGTCAGAAGGGGGATGG - Intergenic
1179166765 21:38941402-38941424 AGGCGGAGCCAGAAGCAGGAAGG - Intergenic
1179177996 21:39022491-39022513 ATCGGGAGCCAGAAGCGAGGTGG - Intergenic
1179246558 21:39638491-39638513 TGGGGGAGCCAGGAGGGAGATGG - Intronic
1179342283 21:40523573-40523595 TGGGGGAGCCAGAAGGGAGATGG - Intronic
1179818993 21:43925525-43925547 GTGGGTAGACAAAAGGGGGAGGG + Intronic
1179918056 21:44490720-44490742 TGGAGGAGCCAGAAGGGAGATGG - Intergenic
1180324268 22:11354597-11354619 ATGGAGACTCAGAAGGGTGAAGG + Intergenic
1180356715 22:11849210-11849232 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1180381546 22:12143121-12143143 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1180468250 22:15635870-15635892 AGGAGGAGCCAGAAGAGGGGAGG + Intergenic
1180930439 22:19586914-19586936 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1180969819 22:19809357-19809379 TGAGGGAGCCAGAAGGGAGATGG - Intronic
1181044000 22:20206067-20206089 TGGGGGAGCCAGAGGGGAGATGG + Intergenic
1181107993 22:20585952-20585974 AGGAGGAGCCAGAAGAGGGGAGG - Intronic
1181471526 22:23143181-23143203 TTTGGGAGGCTGAAGGGGGAGGG + Intronic
1181632343 22:24157779-24157801 AAGCGGAGCCAGGAAGGGGATGG - Intronic
1182119024 22:27774965-27774987 ATGGGGAGCCGGTAGGTGGGAGG + Intronic
1182329836 22:29543380-29543402 ATGGGGAGGAGGAAGGAGGAAGG + Intronic
1182460306 22:30478870-30478892 ATGGGGAGCTGGAACAGGGATGG - Intergenic
1182519383 22:30876688-30876710 GTGGGGAGCCAGGATGGGAAAGG + Intronic
1182649183 22:31836895-31836917 ATGGGGGGCCAGGGGAGGGAAGG - Intronic
1182876360 22:33694707-33694729 GTGGAGAGACAGGAGGGGGAAGG + Intronic
1183063771 22:35350224-35350246 CAGGGGAGCCAGGAGGGAGAGGG - Intergenic
1183119562 22:35719905-35719927 ATGGGGAGCCAGAAAGGGGATGG + Intronic
1183134363 22:35872543-35872565 TGTGGGAGCCAGAAGGGAGATGG + Intronic
1183153116 22:36053602-36053624 ATGGGAAGGGAGAAGGGAGAAGG - Intergenic
1183754399 22:39746734-39746756 CTGGGAGGCCAGCAGGGGGAGGG + Intronic
1184064072 22:42105963-42105985 ATTGGGAGCCAGAAGCTGGATGG + Intergenic
1184345768 22:43911732-43911754 ATGGGGAGACCAAAGAGGGATGG - Intergenic
1184442014 22:44522825-44522847 ATGGGGAGCCTGGACGTGGAGGG + Intergenic
1184580396 22:45413143-45413165 GTCGGGAGCCAGGAGGTGGAGGG + Intronic
1184663234 22:45975179-45975201 TAGGGGTGCCAGGAGGGGGAAGG + Intronic
1184751126 22:46487518-46487540 ATGGTGAGCCCCACGGGGGAGGG + Intronic
1184775555 22:46621090-46621112 ATGGGCAGCTAGAAGTGGGGAGG + Intronic
1184934172 22:47706934-47706956 ATGGGGAGCCAGAAGGGAGATGG + Intergenic
1184950670 22:47840529-47840551 CTGGGGAGGCAGAAAGGGGCAGG - Intergenic
1185075145 22:48678978-48679000 ACGGGGAGCCGGGAGAGGGATGG - Intronic
1185075161 22:48679024-48679046 CTGGGGAGCCAGGAGAGGGATGG - Intronic
1185075219 22:48679193-48679215 ACGGGGAGCCGGGAGAGGGATGG - Intronic
1185075228 22:48679216-48679238 CTGGGGAGCCAGGAGAGGGATGG - Intronic
1185075239 22:48679247-48679269 ATGGGGAGCCGGGAGAGGGATGG - Intronic
1185075248 22:48679270-48679292 ACGGGGAGCCGGAAGAGGGATGG - Intronic
1185075257 22:48679293-48679315 ACGGGGAGCCCGGAGAGGGATGG - Intronic
1185075265 22:48679316-48679338 ACGGGGAGCCGGGAGAGGGATGG - Intronic
1185075275 22:48679339-48679361 ACGGGGAGCCCGGAGAGGGATGG - Intronic
1185075284 22:48679362-48679384 ACGGGGAGCCCGGAGAGGGATGG - Intronic
1185075292 22:48679385-48679407 ACGGGGAGCCGGGAGAGGGATGG - Intronic
1185075302 22:48679408-48679430 ACGGGGAGCCCGGAGAGGGATGG - Intronic
1185075311 22:48679431-48679453 ACGGGGAGCCCGGAGAGGGATGG - Intronic
1185075319 22:48679454-48679476 ACGGGGAGCCGGGAGAGGGATGG - Intronic
1185075329 22:48679477-48679499 ACGGGGAGCCCGGAGAGGGATGG - Intronic
1185075337 22:48679500-48679522 ACGGGGAGCCGGGAGAGGGATGG - Intronic
1185075347 22:48679523-48679545 ACGGGGAGCCCGGAGAGGGATGG - Intronic
1185075355 22:48679546-48679568 ACGGGGAGCCGGGAGAGGGATGG - Intronic
1185075365 22:48679569-48679591 ACGGGGAGCCCGGAGAGGGATGG - Intronic
1185075374 22:48679592-48679614 ACGGGGAGCCCGGAGAGGGATGG - Intronic
1185075382 22:48679615-48679637 ACGGGGAGCCGGGAGAGGGATGG - Intronic
1185075392 22:48679638-48679660 ACGGGGAGCCCGGAGAGGGATGG - Intronic
1185075416 22:48679707-48679729 ACGGGGAGCCGGGAGAGGGATGG - Intronic
1185075425 22:48679730-48679752 CTGGGGAGCCAGGAGAGGGATGG - Intronic
1185106384 22:48872171-48872193 ATGGGGAGGCAGGAGGGACAGGG - Intergenic
1185144441 22:49123351-49123373 ATGGGCAGCCAGATGGAGGCTGG - Intergenic
949160998 3:881790-881812 ATGGAGACCCACAAGGGTGAGGG - Intergenic
949437982 3:4049896-4049918 ATGGGGAGCTGGAAGGGGGATGG + Intronic
949464758 3:4333027-4333049 ATGGGGAGCTGGATAGGGGATGG - Intronic
949617521 3:5770319-5770341 GATGGGAGCCAGAAGGGGGATGG + Intergenic
949684208 3:6549505-6549527 ATGAGGAGCTGGAAAGGGGATGG - Intergenic
949802107 3:7915266-7915288 ATGGGGAGCTGGACAGGGGATGG - Intergenic
949808031 3:7976732-7976754 ATGTGGAGCCAGAAGGGGGATGG - Intergenic
949931638 3:9083142-9083164 ATGGGGAAACATCAGGGGGAGGG - Intronic
949935334 3:9111562-9111584 ATTGTGAGCCAGATGGGGGCAGG - Intronic
949988917 3:9561088-9561110 ATGAAGAGTCAGAAGGGCGAGGG - Intergenic
950056814 3:10031697-10031719 AAGGGTAGACAGAATGGGGAAGG - Intronic
950204440 3:11067920-11067942 ATGGGAAGCTGGAAAGGGGATGG - Intergenic
950552722 3:13676383-13676405 ATCGGGGGTCAGAAGGGAGAGGG + Intergenic
951004353 3:17599455-17599477 ATGGGGAGCTGGAAAGGGGATGG - Intronic
951418254 3:22451190-22451212 TTGGGGAGCCAGAATGCAGATGG + Intergenic
951501331 3:23390434-23390456 AAGGGGAGCTGGAAAGGGGATGG - Intronic
951651379 3:24955173-24955195 AAGGGGAGCTGGAAAGGGGATGG + Intergenic
951651830 3:24959341-24959363 AAGGGGAGCTGGAAAGGGGATGG + Intergenic
951719186 3:25679747-25679769 AGGGGGAGAGAGGAGGGGGAAGG + Intergenic
951731616 3:25816014-25816036 ATGGGGAGCTGGACAGGGGATGG - Intergenic
952002986 3:28808611-28808633 ATAGGGAGCCAGAAGGGGGTTGG + Intergenic
952003338 3:28810859-28810881 ATAGGGAGCCAGGAGGGGGATGG + Intergenic
952039212 3:29241318-29241340 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
952561765 3:34603630-34603652 AAGGGGATCTGGAAGGGGGATGG - Intergenic
952564209 3:34635413-34635435 TGGAGGAGCCAGAAGGGAGATGG + Intergenic
952580259 3:34824564-34824586 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
953088387 3:39697469-39697491 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
953106404 3:39884929-39884951 ATAGGGAGGGAGAAGGGGGGTGG - Intronic
953277297 3:41514762-41514784 ATGGAGACTCAGAAGGGTGAGGG + Intronic
953345477 3:42171964-42171986 ATGGGGACGGAGAGGGGGGATGG - Intronic
953380464 3:42467520-42467542 ATGGAGACTCAGAAGGGTGAAGG + Intergenic
954301757 3:49704069-49704091 ATGGGGTGCCATCAGGGAGAGGG + Intronic
954411579 3:50373518-50373540 AGGGGGAGGGAGGAGGGGGATGG + Intronic
954794225 3:53153345-53153367 GTGGGGAGGCAGAGGGAGGAAGG + Intergenic
954922463 3:54203603-54203625 TGGGGAAGCCAGAAGGGAGATGG + Intronic
955480575 3:59385425-59385447 TGGAGGAGCCAGAAGGGAGATGG - Intergenic
955588971 3:60514045-60514067 ATGGGGAGCTGGAAAGGGAATGG - Intronic
955609172 3:60739112-60739134 ATGGGGAGCTGGCTGGGGGATGG - Intronic
956031075 3:65038772-65038794 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
956181141 3:66519145-66519167 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
956194113 3:66635087-66635109 TCGGGGAGCCAGAAGGGAGATGG - Intergenic
956214210 3:66831833-66831855 AAGGGTGGGCAGAAGGGGGAAGG - Intergenic
956390830 3:68771106-68771128 ATGGGGAGTCAGAAGGGGGATGG - Intronic
956541436 3:70344417-70344439 ATGGGGAACTGGAAGGGGGATGG - Intergenic
956689282 3:71861105-71861127 ATGGGGAGCCTGAAGGGGGATGG - Intergenic
956735276 3:72233254-72233276 ATGGGGAGCCAGAAAGGGGATGG + Intergenic
957029275 3:75221396-75221418 GACGGGAGCCAGAAGGGGGATGG + Intergenic
957058050 3:75459313-75459335 TGGGGGAGCCAGAAGGAAGATGG + Intergenic
957586530 3:82139413-82139435 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
957758413 3:84522776-84522798 ATGGGGAGCTAGAAAGGGGATGG - Intergenic
957984964 3:87562462-87562484 ATGGGAAGCTGGAAAGGGGATGG - Intergenic
958001956 3:87761837-87761859 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
958023675 3:88026268-88026290 ATAGGGAGCTGGAAAGGGGATGG + Intergenic
958074500 3:88658239-88658261 ATGGGGAGCCAGAAGGCGGATGG + Intergenic
958100220 3:88999360-88999382 AAGGGGAGCTGGAAAGGGGATGG - Intergenic
958168956 3:89914834-89914856 ATGAGGAGGTAGAAAGGGGATGG + Intergenic
958524684 3:95240810-95240832 ATGGAGAGCTAGAAAGAGGATGG + Intergenic
958632310 3:96700006-96700028 ATGGGGAGTCAGAAGGGATAGGG - Intergenic
958632904 3:96703937-96703959 TGGGGGAGCCTGAAGGGAGATGG - Intergenic
958663712 3:97106515-97106537 TGGGGAAGCCAGAAGGGGGATGG - Intronic
958855995 3:99386406-99386428 ATAGGGAGCAAGAAGGGGAGAGG + Intergenic
958986471 3:100784868-100784890 TTAGAGACCCAGAAGGGGGAGGG + Intronic
959065213 3:101648982-101649004 ATGGGGAGCTGGAAAGGGGATGG + Exonic
959164387 3:102758731-102758753 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
959269733 3:104192337-104192359 AGGGGGAGCCAGAAGGGAGATGG + Intergenic
959375512 3:105584334-105584356 ATGGGGAGTTGGAAAGGGGATGG - Intergenic
959539603 3:107523961-107523983 AAGGGGAGAGAGAAGAGGGAGGG + Intronic
959694186 3:109231873-109231895 ATGGGGAGCTGGAAAGTGGATGG - Intergenic
960023949 3:112987816-112987838 TAGGGGAGCCAGAAGGGAGATGG + Intergenic
960076204 3:113488586-113488608 TTGGAGACTCAGAAGGGGGAGGG + Intronic
960358178 3:116678771-116678793 ATGGAGAGCTGGAATGGGGATGG - Intronic
960415797 3:117383403-117383425 TGAGGGAGCCAGAAGGGAGATGG - Intergenic
960501609 3:118445051-118445073 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
960647410 3:119902820-119902842 CTTGGGAGCCTGAAGTGGGAGGG - Intronic
961082282 3:124036579-124036601 ATGGGAAATCAGAAGGGAGAAGG - Intergenic
961295403 3:125880402-125880424 TGGGGGAGCCAGAAGGAAGATGG - Intergenic
961345286 3:126260116-126260138 ATGTGGAGAGGGAAGGGGGAGGG - Intergenic
961345503 3:126260850-126260872 ATGGGGAGAAAGAAGAGGGAAGG - Intergenic
961603675 3:128078191-128078213 ATGGGGGTACAGAAGGGGGCTGG - Intronic
961880221 3:130056495-130056517 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
961890500 3:130126774-130126796 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
962074709 3:132069596-132069618 ATGGGGGACCAGAAGGTTGAAGG - Intronic
962075026 3:132072577-132072599 AAGGGAAGCCTGAAGTGGGAAGG + Intronic
962095098 3:132285166-132285188 TGGGGGAGCCAGAAGGGAGATGG + Intronic
963035902 3:141028615-141028637 ATGTGTAGCAAGAAGGGAGATGG + Intergenic
963065028 3:141256842-141256864 GAGGAGAGCCAGAAGTGGGAGGG + Intronic
963102832 3:141622727-141622749 ATGGGGAGCTGAAAGGGGGATGG - Intergenic
963234713 3:142945532-142945554 ATGGGGAGGTGGAAGGGGGATGG + Intergenic
963266919 3:143249117-143249139 AGTGGAAGCCAGTAGGGGGAAGG - Intergenic
963507613 3:146206720-146206742 CTGGGTAGCCAGTAGGTGGAGGG + Exonic
963655899 3:148049711-148049733 ATGGGGAGATAGAAAGGGGATGG - Intergenic
963762202 3:149295276-149295298 CTGGGGAGCTGGAAAGGGGATGG - Intergenic
963938861 3:151081426-151081448 AGGGGGAGGGGGAAGGGGGAGGG - Intergenic
963990635 3:151649456-151649478 AAGGGGAGCCAGGAGAGGGTGGG - Intergenic
963996999 3:151721375-151721397 TGGGGGAGCCGGAAGGGAGATGG + Intergenic
964136577 3:153351532-153351554 ATGGGGAGTTGGAAGGGGGATGG + Intergenic
964247453 3:154669976-154669998 ATGGGGAGCTGGAAAGGGCATGG - Intergenic
964308026 3:155361691-155361713 TGGGGGAGCTAGAAGGGAGACGG + Intergenic
964355364 3:155846787-155846809 ATGGGGAGACAGAGGTGAGAAGG - Intronic
964669466 3:159209345-159209367 AAGGGGAGCCGGAAGGGGGATGG - Intronic
965067130 3:163864339-163864361 ATGGGGATCCAGGAGGATGAGGG - Intergenic
965085319 3:164088750-164088772 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
965185275 3:165454898-165454920 ACTGGGAGCCAGAAGGGGGATGG + Intergenic
965300827 3:167002553-167002575 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
965321020 3:167251168-167251190 TGGGGGAGCCAGAAGGGAGATGG - Intronic
965420849 3:168456339-168456361 ATGGGGAGCTTGAAGGGTTATGG + Intergenic
965535010 3:169814206-169814228 ATGGGGAGCCAGAAAGGGAATGG + Intergenic
966642267 3:182204168-182204190 TTTGGGAGCCAGCAGGTGGAGGG - Intergenic
967070892 3:185961443-185961465 TTGGGGAGCTAGACAGGGGATGG + Intergenic
967188817 3:186967764-186967786 ATGGAGGCCCAGAAAGGGGAAGG + Intronic
967501043 3:190197735-190197757 AAGGGGAGAAAGAAGGGGAAAGG + Intergenic
968261104 3:197324794-197324816 ATTGGGAGGCAGAAGGGGCCAGG + Intergenic
968261119 3:197324840-197324862 ATTGGGAGGCAGAAGGGGCCAGG + Intergenic
968517536 4:1021177-1021199 ATGGGGACCCAGGCAGGGGATGG + Intronic
968741726 4:2334737-2334759 AAGGGGAGGGGGAAGGGGGAGGG - Intronic
968966319 4:3770739-3770761 ATGGGGTGCCAGCATGGGGAGGG + Intergenic
968978660 4:3835053-3835075 ATGGAGAGAGAGAAGAGGGAAGG + Intergenic
968992610 4:3924850-3924872 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
969001885 4:3989189-3989211 TGGGGGAGCCAGAAGGGAGGTGG + Intergenic
969122535 4:4920593-4920615 ATGGGGTGGCAGACGGGGAAGGG - Intergenic
969511786 4:7622206-7622228 ACAGGGAGCAAGAAGGAGGAGGG + Intronic
969571386 4:8010741-8010763 ATGGAGAGGCAGAGGGGGCAGGG + Intronic
969752119 4:9119346-9119368 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
969812034 4:9655622-9655644 TGGGGGAGCCAGAAGGGAGGTGG - Intergenic
969822741 4:9732772-9732794 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
969867436 4:10084891-10084913 GCGGGGAGCCACAAGGGGGTCGG + Intronic
970046641 4:11861847-11861869 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
970054648 4:11957219-11957241 TGGGGGAGACAGAAGGGAGATGG + Intergenic
970234437 4:13944477-13944499 ATGGGGAGCCAGAAGGGAGATGG - Intergenic
970273164 4:14368493-14368515 ATGGAGAGCCAGAAGGGGGATGG + Intergenic
970697560 4:18696215-18696237 TGGAGGAGCCAGAAGGGAGATGG + Intergenic
970871074 4:20817523-20817545 AAGAGGAGCGAAAAGGGGGAAGG - Intronic
970943321 4:21661183-21661205 ATGGGGAGCTGGAAAGGAGATGG - Intronic
971005476 4:22370002-22370024 AAGGGGAGCCAAAAAGGGGATGG - Intronic
971393714 4:26209662-26209684 AGGGGGAGACGGAAGGAGGAAGG - Intronic
971427330 4:26529510-26529532 AAGGGGAGCAGGAAAGGGGATGG + Intergenic
971502062 4:27328366-27328388 ATGGGAAGCTGGAAGGGGGATGG + Intergenic
971578467 4:28305518-28305540 GTGGGGAACCATACGGGGGATGG - Intergenic
971742677 4:30540152-30540174 ATGGGGATCTGGAAAGGGGATGG + Intergenic
971796823 4:31238931-31238953 ATGGGAAGCTGGAAAGGGGATGG + Intergenic
971840239 4:31842198-31842220 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
971887598 4:32473406-32473428 ATGGCGAGCCAGAAGAGGGATGG + Intergenic
971947966 4:33306007-33306029 ATGGGGAGCTAGAAAAGAGATGG - Intergenic
971986915 4:33837988-33838010 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
972390251 4:38607010-38607032 ATGGGGAGTCAGAAGGGGGATGG + Intergenic
972805009 4:42520538-42520560 ATGGAGAGCGAGAAGGTGGAGGG + Intronic
973057446 4:45678812-45678834 TGGGGGAGCCAGAAGGGAAATGG + Intergenic
973134492 4:46689493-46689515 GATGCGAGCCAGAAGGGGGATGG - Intergenic
973253559 4:48085808-48085830 ATGGGGAGCTGGAAATGGGATGG - Intronic
973371471 4:49251649-49251671 ATGGGAAGCTGGAAAGGGGATGG - Intergenic
973389537 4:49543662-49543684 ATGGGAAGCTGGAAAGGGGATGG + Intergenic
973728935 4:53804583-53804605 CTGAGGAGCCAGAAGTTGGATGG + Intronic
974012277 4:56617832-56617854 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
974032797 4:56790990-56791012 ATGGAGACTCAGAAGAGGGAGGG - Intergenic
974121118 4:57640316-57640338 ATGGGGAGCCGGAAGGTGAAGGG - Intergenic
974169302 4:58245561-58245583 ATGGGGAGCTTAAAGGGGGATGG - Intergenic
974250097 4:59374902-59374924 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
974303289 4:60098155-60098177 ATGGGGAGCCAGAAGAGGAATGG - Intergenic
974368639 4:60985699-60985721 ATGGGGAGCTAGAAAGGGGATGG + Intergenic
974537133 4:63187141-63187163 ATGGGGATCCATACTGGGGATGG - Intergenic
974669705 4:65014149-65014171 TGGGGGAGCCAGAAAGGAGATGG + Intergenic
974752064 4:66154332-66154354 TGGGGGAGCCAGAAAGGAGACGG - Intergenic
974978122 4:68917479-68917501 ATGGGGAGCTGGAATGGTGATGG + Intergenic
974983753 4:68993918-68993940 TGAGGGAGCCAGAAAGGGGACGG + Intergenic
974993970 4:69129407-69129429 TGGGGGAGCCAGAAAGGGGACGG - Intronic
975426079 4:74229397-74229419 AGAGGTAGCCAGAACGGGGAGGG + Intronic
975460863 4:74651285-74651307 AGGGGGAGGGAGGAGGGGGAGGG + Intergenic
975460870 4:74651298-74651320 AGGGGGAGGGAGGAGGGGGAGGG + Intergenic
975460877 4:74651311-74651333 AGGGGGAGGGAGGAGGGGGAGGG + Intergenic
975580909 4:75906346-75906368 ATGGGGAGCTGGAACGGGGACGG - Intergenic
975599001 4:76079696-76079718 GTGGGAAGCCATAATGGGGAGGG + Intronic
975707785 4:77128121-77128143 AAGGGGAGCTGGAATGGGGATGG + Intergenic
975891368 4:79032631-79032653 ATGGAGAGGCAGAGGTGGGAGGG + Intergenic
976070635 4:81236081-81236103 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
976723664 4:88194852-88194874 ATGGGGAGCCCGATGGTGTAAGG + Intronic
976751436 4:88454568-88454590 TGGGGGAGCCAGAAGGGAGTTGG - Intergenic
977306295 4:95327773-95327795 AAGGGGAGCTGGAAGGAGGATGG - Intronic
977441200 4:97070342-97070364 ATGGGCAGCTGGAAGGGGGATGG - Intergenic
977756949 4:100682782-100682804 CAGGGGAGCCAGAAGGGAGATGG - Intronic
978310141 4:107378655-107378677 ATGGGGAGACAGTAGGGGGATGG + Intergenic
978414784 4:108463778-108463800 ATGGGGAGCCAGAAGGGGTATGG - Intergenic
978529330 4:109698409-109698431 TTTGGGAGTCAGAAGGGGGATGG - Intronic
978988448 4:115046218-115046240 ATAGGGAGGCAGAATGGGGCAGG - Intronic
979188666 4:117831763-117831785 ATGGGAGGCCAGAAGGGGAATGG + Intergenic
979281463 4:118872827-118872849 ATGGAGACTCAAAAGGGGGAGGG - Intronic
979392256 4:120141143-120141165 ATGGAGAGCTGGAAGAGGGATGG - Intergenic
979537180 4:121836349-121836371 ATGAGGAGGCATAAGTGGGATGG - Intronic
979728403 4:123992247-123992269 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
979771057 4:124525400-124525422 CATGGGAGCTAGAAGGGGGATGG - Intergenic
979851180 4:125573117-125573139 AAGGGGAGGAAAAAGGGGGAAGG - Intergenic
980006148 4:127544562-127544584 ATGTGGAGCTGGAAAGGGGATGG - Intergenic
980097039 4:128501894-128501916 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
980097313 4:128504692-128504714 ATGGAGAGCTGGAAAGGGGATGG + Intergenic
980438299 4:132809539-132809561 TGGGGAGGCCAGAAGGGGGATGG - Intergenic
980534081 4:134092383-134092405 ATAGGGAGCTTGAAAGGGGATGG - Intergenic
980554610 4:134387052-134387074 ATGGGGAGCTGGAAAAGGGATGG - Intergenic
980585584 4:134810605-134810627 TTGGGGAGCCTGAAGCAGGAGGG - Intergenic
980603134 4:135052251-135052273 TTTGGGAGGCAGAAGGGGGACGG - Intergenic
980871459 4:138615753-138615775 ATGGGGACCTGGAAAGGGGATGG - Intergenic
981317210 4:143351297-143351319 TGGGGGAGCCAGAAGGCAGATGG + Intronic
981361589 4:143852065-143852087 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
981362769 4:143866549-143866571 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
981373502 4:143987349-143987371 ATGGAGAGCTGGAAAGGGGATGG - Intergenic
981423800 4:144581083-144581105 ATGGGGAGCCAAAAGGGGGATGG - Intergenic
981592247 4:146376602-146376624 ATGGGGAGCTGGAAAGGGGATGG - Intronic
981705442 4:147654635-147654657 ATGGGGGGCTAGATGGAGGATGG - Intronic
981815859 4:148829867-148829889 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
982255031 4:153443344-153443366 AAGAGAAGCAAGAAGGGGGAAGG + Intergenic
982291568 4:153788220-153788242 TTGGGGTGCCAGTAGCGGGAAGG - Intronic
982315111 4:154023985-154024007 TGGGGGAGCCAGAAGAGAGATGG - Intergenic
982325809 4:154127277-154127299 GTGGGGAGCTAGAAAGGGGATGG + Intergenic
982504175 4:156197018-156197040 ATGGGGAGCCAGAAGAAGCATGG - Intergenic
982701121 4:158660491-158660513 ATGGGGATCCATACTGGGGATGG - Intergenic
982869145 4:160553752-160553774 AAGGGGAGCTAGAAGGCAGATGG + Intergenic
982918461 4:161244615-161244637 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
982947779 4:161648041-161648063 TGGGGGAGCCAGTAGGGAGATGG - Intronic
983145961 4:164215215-164215237 TGGGGGAGCCAGAAGAGAGATGG + Intronic
983162755 4:164437469-164437491 ATTGGGAGCAAGTAGGGGGAAGG - Intergenic
983511144 4:168610706-168610728 TTGGAGAGCCAGAAGGTGGTTGG - Intronic
983717674 4:170805271-170805293 ATGGGAGGCCAGAAGAGAGATGG - Intergenic
983781428 4:171674671-171674693 ATGTGGAGCCGGAAGGGGGCTGG - Intergenic
983810195 4:172051473-172051495 AGGGGGAGCTGGAATGGGGATGG + Intronic
984098059 4:175455508-175455530 ATGGGGAACTGGAAAGGGGATGG + Intergenic
984105554 4:175541175-175541197 GAGGGGAGCTAGAAAGGGGATGG + Intergenic
984129543 4:175856694-175856716 ATGGGGACCTGGAAAGGGGATGG + Intronic
984245934 4:177275333-177275355 AAGGGGAGCTGGAAGGGGGATGG - Intergenic
984261249 4:177445337-177445359 CGGGGGAACCAGAAGGGAGACGG - Intergenic
984271896 4:177557716-177557738 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
984289852 4:177781647-177781669 TAGGGGAGCCAGAAGTGAGATGG + Intronic
984300572 4:177912119-177912141 AAGGGGAGCTGGAAAGGGGATGG + Intronic
984321770 4:178206677-178206699 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
984520533 4:180796374-180796396 ATGGGTAACTAGAAGGGGGATGG + Intergenic
984573963 4:181425948-181425970 ATGGGGAGCCAGGAAGACGAAGG + Intergenic
984790098 4:183607426-183607448 GTGGGGAGCCGAAAGGGAGATGG + Intergenic
985138307 4:186812044-186812066 ATGGGGAGCTGAAAGGTGGATGG + Intergenic
985228143 4:187784675-187784697 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
985293181 4:188407019-188407041 ATGGGGAGCTGGAAGGTGGATGG - Intergenic
985688007 5:1292262-1292284 ACTGGGAGCCAAAAGGGGGCTGG + Intronic
985854852 5:2416794-2416816 ATAGGGAACCAGAAGGGGGATGG - Intergenic
986165274 5:5267444-5267466 ATGGGGAGCCAGAAAGGGGATGG + Intronic
986230964 5:5864561-5864583 ATGGGGAGCTGGAAGGTGGAGGG + Intergenic
986484018 5:8217288-8217310 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
986588699 5:9346281-9346303 AAGGGGAGCTGGAAAGGGGATGG - Intronic
986619148 5:9652507-9652529 AGGGGGAGCCACAAGACGGAAGG + Intronic
986687498 5:10287474-10287496 ATGGAGACTCAGAAGGGGGAGGG + Intronic
987005705 5:13707253-13707275 ATGGGGAGCCAGAAGGGGGATGG - Intronic
987190225 5:15469921-15469943 ATGGGGAGCTGGTAAGGGGATGG + Intergenic
987212137 5:15693838-15693860 ATGGGGAGCCAGAAGGGGGATGG - Intronic
987251755 5:16107906-16107928 ATGGGGAGCTGGAAGGGGGATGG - Intronic
987397988 5:17443576-17443598 CAGGGGAGACAGAAGGGAGATGG - Intergenic
987504836 5:18754368-18754390 ATGGGGAGCTGGAAGTGGGATGG + Intergenic
987715057 5:21557734-21557756 ATGGGGAGTTGGAAAGGGGATGG + Intergenic
987764022 5:22201952-22201974 GTGGGAAGTCAGAAGTGGGAAGG + Intronic
988038103 5:25853472-25853494 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
988205339 5:28126516-28126538 ATGGAGAGCCAGAAGGGGGATGG - Intergenic
988267230 5:28967709-28967731 TTGGGGAGCCAGAGGGGAGATGG - Intergenic
988457621 5:31400641-31400663 ATGGGGAGCAGGAAGGAGGAGGG - Exonic
988567603 5:32331842-32331864 ACTGGGAGCCAGAAAGGGGGCGG + Intergenic
988922845 5:35960800-35960822 ATGGGGAGCTGGAAAGGAGACGG + Intronic
989204502 5:38797734-38797756 TGGGGGAGCCAGAAGGGAGCTGG + Intergenic
989558597 5:42825591-42825613 ATGGGGAGCTGGAAAGCGGATGG - Intronic
989687808 5:44110067-44110089 AAGGGGAGCTGGAAAGGGGATGG - Intergenic
989719123 5:44504014-44504036 TTGGGGAGCTGGAAGGGGGATGG - Intergenic
989983255 5:50667326-50667348 CGCGGGAGCCAAAAGGGGGAGGG + Intronic
990128405 5:52548322-52548344 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
990193801 5:53290443-53290465 ATGGGGAGCTGGAACAGGGATGG - Intergenic
990352642 5:54934275-54934297 ATGGGGTGGCAGCAGGGGGAAGG + Intergenic
990463781 5:56053398-56053420 AAAGGGAGCTGGAAGGGGGATGG - Intergenic
990499023 5:56376539-56376561 ATGGGGAGCTGGAGAGGGGATGG + Intergenic
990510441 5:56484586-56484608 ATGGGGAAGCAGGAGGGGGATGG - Intergenic
990560627 5:56980054-56980076 TGGGGGAGCCAGAAGGGAGGTGG + Intergenic
990585541 5:57207714-57207736 ATGGGAAGCCAGGAGGGAGATGG + Intronic
990589746 5:57249961-57249983 AGGGGGAGGGGGAAGGGGGAAGG - Intronic
990698236 5:58446574-58446596 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
990792351 5:59496099-59496121 TGGGGGAGCCAGAAGGGAGATGG + Intronic
991082333 5:62614901-62614923 ATGGGGAGCTGGAAAGGGTATGG + Intronic
991207450 5:64065892-64065914 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
991297055 5:65092862-65092884 TTGGGGTGGCAGATGGGGGAGGG - Intergenic
991325173 5:65423154-65423176 CTGGAGATTCAGAAGGGGGAAGG + Intronic
991425725 5:66489736-66489758 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
991648046 5:68821115-68821137 ATGAGGAGGCAAAAGGGTGAAGG - Intergenic
991679836 5:69127822-69127844 ATGAGAAGCCAGAAGCAGGAAGG - Intronic
992093648 5:73340611-73340633 TGGGGGAGGCAGAAGGGGGATGG - Intergenic
992186569 5:74250251-74250273 ATGGGGAGACACAAGGGTGCTGG + Intergenic
992226086 5:74620787-74620809 ATGGGGAGCTGGAAAGAGGATGG + Intergenic
992349663 5:75916223-75916245 AGGAGGAACCAGAAGGGGAAGGG - Intergenic
992474515 5:77088562-77088584 ATGGGGAGCTGGAAAGGGGGTGG + Intergenic
992526725 5:77618834-77618856 AGGATAAGCCAGAAGGGGGATGG + Intronic
992637122 5:78735748-78735770 ATGGGGAGCTAAAAGGGGGATGG - Intronic
992672752 5:79076138-79076160 ATGGGGAGCCAGAAGGGGGATGG + Intronic
992756181 5:79908289-79908311 ATGGGGTGGAGGAAGGGGGAAGG + Intergenic
992904619 5:81334108-81334130 ATGGGGAGCCAGAAGGAGGATGG - Intronic
992992494 5:82298432-82298454 ATGGGGAGCTGGAAGGGTGATGG + Intronic
993036247 5:82760789-82760811 AAGGGGAGCTGGAAAGGGGATGG - Intergenic
993188104 5:84645940-84645962 ATGGGGAGCCAGAAGAGGGATGG - Intergenic
993492474 5:88568931-88568953 GTGGGTCGGCAGAAGGGGGAGGG + Intergenic
994533208 5:100992887-100992909 ATGGGGAGCTGGAAAGGGAATGG + Intergenic
994762820 5:103878220-103878242 ATGGGAAGCTGGAAAGGGGATGG + Intergenic
994819290 5:104628132-104628154 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
994998380 5:107094670-107094692 ATGGGGAGCTGGAAAAGGGATGG + Intergenic
994999029 5:107103482-107103504 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
995284264 5:110368782-110368804 AGGGGGAGCCAAACAGGGGATGG + Intronic
995494484 5:112726336-112726358 ATGGGGAGCTGGAAGGGGGATGG + Intronic
995533644 5:113114787-113114809 AAGGGGAGCTAGAAGGGGGATGG - Intronic
995622201 5:114039010-114039032 ATGGGGAGCCAAGATGGGCATGG + Intergenic
996215056 5:120856195-120856217 TAGGGAAGCCAGAAGGGGGATGG - Intergenic
996486598 5:124042268-124042290 CTGGGGAGCCAGAAGGGAGATGG - Intergenic
996576729 5:124983967-124983989 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
997318146 5:132955047-132955069 ATGGGGAGCTGGAAAAGGGATGG + Intronic
997600657 5:135136175-135136197 AAGGGGAGCCAGAAGGGACTTGG + Intronic
997716756 5:136048363-136048385 ATGGAGGGTCAGAAGAGGGAAGG - Intronic
998547598 5:143044297-143044319 ATGAGAAGCCAGAAGAAGGAAGG - Intronic
998771589 5:145551948-145551970 ATGGGGAGACAGAAGGCGGGAGG - Intronic
998791162 5:145767323-145767345 ATGGGGAGCTGGAAAGGGGATGG - Intronic
998861404 5:146447536-146447558 ATGGGGTTTAAGAAGGGGGAAGG + Intronic
998868521 5:146529853-146529875 ATGGGGAACTGGAAGGGGGATGG - Intergenic
999320807 5:150613952-150613974 ATGGGGAATCAGAAGGAGGCTGG + Intronic
999537004 5:152528682-152528704 ATAAGGAGCCAGAAGGGGGATGG + Intergenic
999668495 5:153937322-153937344 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
999755304 5:154659756-154659778 CTGGGGTGCCATAAGTGGGAAGG - Intergenic
999965347 5:156803528-156803550 TTGGGAAACCAGAATGGGGAGGG + Intergenic
1000167923 5:158673260-158673282 TGGGAGAGCCAGAAGGGAGATGG + Intergenic
1000234449 5:159344555-159344577 ATGGGGAGCTAGAAAGGGGATGG + Intergenic
1000470202 5:161631079-161631101 ATGGGGGGCCAGAAGGGGGATGG + Intronic
1000516443 5:162241228-162241250 ATGGGGAGCCAGAAGCCGGATGG + Intergenic
1000658892 5:163915412-163915434 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1000742511 5:164987230-164987252 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1000852882 5:166362125-166362147 GTGGGGAGCTGGAAAGGGGATGG + Intergenic
1000867956 5:166538429-166538451 ATGGGGAGTTGGAAGGGGGATGG - Intergenic
1000949424 5:167462566-167462588 ATGGGGAGCTGGAAAGGGGATGG + Intronic
1001181151 5:169521886-169521908 TAGGGGAGCCAGAAGGGAGATGG - Intergenic
1001214917 5:169846855-169846877 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1001246384 5:170108281-170108303 AAGGGGCGCCTGATGGGGGAGGG - Exonic
1001442059 5:171750743-171750765 AAGGGGAACCAGAGGGGGTAGGG - Intergenic
1001619564 5:173071945-173071967 CTTGGGAGGCAGAAGTGGGAGGG + Intronic
1001732652 5:173971908-173971930 GTGTGGAGGCAGCAGGGGGAGGG + Intergenic
1001737797 5:174021047-174021069 AAGGGGAAGCAGAAGGGGAAAGG + Intergenic
1001786573 5:174418842-174418864 AGGGGGAGAGGGAAGGGGGAGGG + Intergenic
1001940118 5:175734337-175734359 TGGGGGAGACAGAAGGGAGATGG - Intergenic
1001969578 5:175943828-175943850 AAGGAGAGCTAGAAAGGGGATGG + Intronic
1002132862 5:177092100-177092122 ATGGGGAGCCAGGTGGTGGAGGG + Intronic
1002247857 5:177899925-177899947 AAGGAGAGCTAGAAAGGGGATGG - Intergenic
1002271346 5:178074533-178074555 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1002434990 5:179225740-179225762 GGGGGAAGCCAGAAGGAGGATGG - Intronic
1002475712 5:179464583-179464605 ATGGGGAGCCAGAAGGGGAATGG + Intergenic
1002762648 6:214046-214068 ATGGGGAGCTGGAAGGAGGAGGG - Intergenic
1002795669 6:469425-469447 AGGGGGAGAGAGGAGGGGGACGG - Intergenic
1002842772 6:920794-920816 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1002843354 6:924546-924568 TGGGGCAGCCAGAAGGGAGATGG - Intergenic
1003131221 6:3396794-3396816 TGCGGGAGCCAGAAGGGAGATGG - Intronic
1003423159 6:5976110-5976132 ATGGGGAGCCAGCTAGGAGACGG - Intergenic
1003485796 6:6578049-6578071 TTTGGGAGGCAGAAGTGGGAGGG + Intergenic
1003498705 6:6686947-6686969 ATGGGAGGCCTGGAGGGGGATGG - Intergenic
1003499783 6:6694838-6694860 TGGGGGAGCCAGAAGGGAGACGG + Intergenic
1003533388 6:6955960-6955982 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1003593136 6:7452714-7452736 ATGGGGAGCTGGAGGGGGAATGG - Intergenic
1003765793 6:9234958-9234980 ATTGGGAGGCAAAAGAGGGAGGG + Intergenic
1003783091 6:9451442-9451464 AAGGGGAGCTAGAAAAGGGATGG - Intergenic
1003890069 6:10556143-10556165 ACGGGGAGGCAGAGGGAGGAGGG + Intronic
1004027307 6:11831705-11831727 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1004170671 6:13293323-13293345 TTGGGGACTCAGAAGGGGGAGGG + Intronic
1004417249 6:15436295-15436317 TGGGAGAGCCAGAAGGGAGATGG + Intronic
1004469548 6:15917008-15917030 ATCGGGAGCTGGAAGGGGGATGG + Intergenic
1004531349 6:16458196-16458218 GTGGGGATCCATAATGGGGATGG - Intronic
1004554779 6:16685068-16685090 TTCTGGAGCCAGAAGTGGGAGGG - Intronic
1004647204 6:17573913-17573935 ATGGGGAGCTAGAAAGGGAATGG + Intergenic
1004746192 6:18511223-18511245 TGGGGAGGCCAGAAGGGGGATGG - Intergenic
1004953621 6:20702502-20702524 TGGGGGAGCCAGAAGGGAGATGG + Intronic
1005029293 6:21494043-21494065 ATGGGGAGCCAGAAGGGGTGTGG - Intergenic
1005363373 6:25053672-25053694 AAGGGGAGCCAAAGAGGGGATGG + Intergenic
1005492971 6:26363719-26363741 TTGGGGAGGGGGAAGGGGGAGGG + Intergenic
1005794758 6:29347960-29347982 TGGGGGAGCCAGAAGGGAAATGG + Intergenic
1005849507 6:29810917-29810939 ATGGAGACCCAGAAGGGTAAGGG + Intergenic
1006079897 6:31559131-31559153 TTGGGGAGCCAGGGAGGGGAGGG - Intergenic
1006180633 6:32151643-32151665 AGGGGGAGACAGAAAGAGGAGGG + Intronic
1006208931 6:32376045-32376067 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1006299506 6:33186117-33186139 AAGGGGAGGTAGTAGGGGGAAGG - Intronic
1006385564 6:33728887-33728909 AAGGGCAGACAGACGGGGGAGGG - Intronic
1006450477 6:34103121-34103143 ATGGGGAGACAGAGGTGGCATGG - Intronic
1006718100 6:36132730-36132752 CTGGGGAGCAAGGTGGGGGAGGG + Intronic
1006988757 6:38194844-38194866 ATGGGGAGGCAGGAGAGGCAGGG + Intronic
1007099042 6:39231940-39231962 ATGGAGAGCAAGAAGGAAGAAGG - Intergenic
1007393285 6:41562805-41562827 ATGGGGAGACAGGAGGGAGGGGG - Intronic
1007736465 6:43985220-43985242 ATGGGGAGCAAGCATGGGGTGGG - Intergenic
1008420322 6:51291701-51291723 ATGTGGAGACAGGAGGGGGATGG + Intergenic
1008730865 6:54481193-54481215 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1008996929 6:57669697-57669719 ATTGGGAGGCAGAAGAAGGAGGG + Intergenic
1009001666 6:57724310-57724332 ATGGGGAGTTGGAAAGGGGATGG - Intergenic
1009349907 6:62661376-62661398 ATGGAGAGCTGGAAGTGGGATGG + Intergenic
1009698485 6:67142583-67142605 ATGGGGAACTAGAAAGGGGATGG - Intergenic
1010028374 6:71245743-71245765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
1010494222 6:76513818-76513840 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1010503986 6:76633749-76633771 TGGAGGAGCCAGAAGGGAGATGG + Intergenic
1010628467 6:78168273-78168295 ATGGGGAACCAGAAGGGGGATGG + Intergenic
1011227723 6:85126519-85126541 AGGGGGAGCCAGCAGGAGCAAGG - Intergenic
1011261696 6:85476696-85476718 ATGGGGAGCTGGAAAGGGGATGG + Intronic
1011353328 6:86446890-86446912 ATGAGGAGCTGGAAAGGGGATGG + Intergenic
1011493518 6:87916513-87916535 AAGGGGAGCTGAAAGGGGGATGG - Intergenic
1011616613 6:89203281-89203303 AAGGGGAGCCTGAAAGGAGACGG - Intronic
1011639594 6:89406587-89406609 TAGGGGAGCCAGAAGGGAGACGG - Intronic
1011771285 6:90676225-90676247 TTGGGGAGGGAGAAGGAGGATGG + Intergenic
1011801603 6:91022171-91022193 TGGGGAAGCCAGAAGGGAGATGG - Intergenic
1012042978 6:94234048-94234070 ATGGGGAGCAGGAAGGGGGATGG - Intergenic
1012072434 6:94639908-94639930 TGGGGGAGCCAGAAGGAAGATGG - Intergenic
1012263242 6:97111808-97111830 AAGGGGAGCTGGAAAGGGGATGG + Intronic
1012319046 6:97819806-97819828 AAGGGGAGGCAGAACAGGGAAGG - Intergenic
1012440198 6:99255180-99255202 TGGGGGAGGCAGAAGGGAGACGG - Intergenic
1012603668 6:101130889-101130911 CTGGGTGGCAAGAAGGGGGAAGG + Intergenic
1012945458 6:105461162-105461184 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1013476109 6:110508791-110508813 ATGGGGAGCTAGAAGGGAGATGG - Intergenic
1013562946 6:111324696-111324718 AGGGGGAGGCGGAAGAGGGAAGG + Intronic
1013826063 6:114213095-114213117 ATGGAGAGCTAGAAAGGGGATGG + Intronic
1013946466 6:115728447-115728469 GGGGGAAGCCAAAAGGGGGATGG - Intergenic
1014092627 6:117421414-117421436 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1014247246 6:119081682-119081704 TGGGGTAGCCAGAAGGGAGATGG + Intronic
1014332326 6:120085504-120085526 ATGGGGAGGGGGCAGGGGGAAGG - Intergenic
1014635628 6:123843317-123843339 ATGGGGAGCTGGAAAGGGGATGG + Intronic
1014684315 6:124477345-124477367 ATTGGGAGGGAGAAGGGAGATGG + Intronic
1014778127 6:125533788-125533810 TTGGGGAGGCAGAAAGGGGCAGG + Intergenic
1014812412 6:125901851-125901873 ATGGGGAGCTGGAAAGGAGATGG + Intronic
1014825803 6:126047448-126047470 ATGGGGAGCTGTAAAGGGGATGG - Intergenic
1014992816 6:128103239-128103261 ATGGGGACCCGGAAAGGGGGTGG - Intronic
1015042867 6:128742809-128742831 ATGGGGAGCCAGAAAGGGGATGG - Intergenic
1015113392 6:129619346-129619368 AGGGGGAGGGAAAAGGGGGAGGG + Intronic
1015113398 6:129619359-129619381 AGGGGGAGGGAAAAGGGGGAGGG + Intronic
1015194475 6:130510326-130510348 AAGGGGAGCTAAAAAGGGGATGG + Intergenic
1015288549 6:131511435-131511457 ATGGGGAGCTAGAAAGGGGATGG - Intergenic
1015349006 6:132195033-132195055 ACGGGGAGCTGGAAGGGGGATGG + Intergenic
1015553005 6:134431619-134431641 ATAGGGAGTAAGAAGGAGGACGG + Intergenic
1015636266 6:135277801-135277823 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
1015729616 6:136334745-136334767 TTGGGAAGCCAGAAGGGAGATGG - Intergenic
1016021002 6:139236046-139236068 TGGGGAGGCCAGAAGGGGGAAGG - Intergenic
1016109587 6:140206077-140206099 TGGGGGAGCCAGAAAGGAGATGG - Intergenic
1016155914 6:140808564-140808586 ATGGGAAGCTGGAAGGGGGATGG + Intergenic
1016532797 6:145076540-145076562 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1016780603 6:147953472-147953494 ATTGGGAGCCAAAACAGGGATGG - Intergenic
1017229154 6:152053401-152053423 AGGGAGAGACAGAAGGAGGAAGG - Intronic
1017506684 6:155074929-155074951 CTGGGGAGTCAGAGGGTGGAGGG + Intronic
1017633611 6:156422844-156422866 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1017722232 6:157251738-157251760 CTGGGGAGCGACAAGAGGGAAGG - Intergenic
1017782359 6:157725794-157725816 ATGGGGAGTTGGAAAGGGGATGG - Intronic
1017980135 6:159394173-159394195 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1017981189 6:159402170-159402192 CAGGAGAGCCAGAAAGGGGAGGG - Intergenic
1018201437 6:161399168-161399190 ATGGGGAGCTGGAAAGGGGATGG - Intronic
1018278016 6:162153680-162153702 AGGGGGAGCTGGAAAGGGGATGG + Intronic
1018620405 6:165725121-165725143 AATGGGAGCCAGAAGAGGGCTGG - Intronic
1018739545 6:166717006-166717028 ATCCGGAGCCAGAAGGAGCAGGG + Intronic
1018748388 6:166780358-166780380 ATGGGGAGAGAGATGGGGGAAGG + Intronic
1018808481 6:167280231-167280253 ACGGGGAGCCTGCAGGGGGTAGG - Intronic
1018813288 6:167313186-167313208 TTGGGGACCCAGAAGGTGGCTGG - Intronic
1018831086 6:167444115-167444137 AAGGGGAGCTGGAAGTGGGATGG + Intergenic
1018843043 6:167532196-167532218 TGGGGGAGCTAGAAGGGAGATGG - Intergenic
1018953750 6:168394592-168394614 ATGGAGAGAGAGATGGGGGAAGG + Intergenic
1019042314 6:169117467-169117489 AAGGGGAGCTGAAAGGGGGATGG - Intergenic
1019136560 6:169912166-169912188 TGGGGGAGCCAGAAGGGAGGTGG - Intergenic
1019158193 6:170052779-170052801 AGGGGGAGGCGGAGGGGGGAGGG - Intergenic
1020315256 7:6901206-6901228 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1020389881 7:7646671-7646693 ATGGGGAGCTGGAGAGGGGATGG + Intronic
1021081530 7:16370774-16370796 ATGGGGTGGCAGGTGGGGGAGGG - Intronic
1021083054 7:16386147-16386169 ATGGGGAGCTAAAAGAGGGATGG + Intronic
1021179944 7:17494658-17494680 ATGAGGAGCTGGAAGGGGAATGG - Intergenic
1021560501 7:21964749-21964771 ATGGAGAGCTGGAAGGGGGATGG - Intergenic
1021820707 7:24494928-24494950 ATGGGGAGCTGGAAGGGGTATGG + Intergenic
1022517811 7:30987045-30987067 GGGGGGAGCCAGAAGGGAGCGGG + Intronic
1022569158 7:31434412-31434434 TTTGGGAGCAAGAAGGGTGAGGG - Intergenic
1022901072 7:34811256-34811278 ATGGGGAACTGGAAGGGGGATGG + Intronic
1022992760 7:35724910-35724932 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1023253539 7:38290687-38290709 TGGGGGAGCCAGACGGGAGATGG - Intergenic
1023829359 7:44029815-44029837 ACGGGGAGGGAGAAGGTGGAAGG - Intergenic
1024203063 7:47126034-47126056 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1024268132 7:47622097-47622119 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1024870811 7:53960198-53960220 GTGGGGATCCATACGGGGGATGG + Intergenic
1025273537 7:57550943-57550965 TGCGGGAGCCAGAAGGGAGATGG - Intergenic
1025600640 7:62993348-62993370 ATGGGGTGCGGGGAGGGGGAAGG - Intergenic
1025740629 7:64192856-64192878 TTGTGGGGCCAGCAGGGGGAAGG + Intronic
1025777360 7:64570516-64570538 AGGGGGAGGGGGAAGGGGGAGGG + Intergenic
1026111066 7:67459302-67459324 ATGGGGATCCAGAAGGGGGATGG + Intergenic
1026248407 7:68644917-68644939 ATGGGGAGCTAGAAGGGGGATGG - Intergenic
1026272018 7:68844936-68844958 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1026281015 7:68921806-68921828 AAGGGGAGCTGGAAAGGGGATGG - Intergenic
1026313925 7:69211683-69211705 ATGGGGAGCCAGAAGGAGGGTGG - Intergenic
1026557782 7:71422892-71422914 ATGGGGAGCAGGAAGGGGGATGG + Intronic
1026741560 7:72981865-72981887 AAGGGGAGGGAGAAGGGGCAGGG + Intergenic
1026801394 7:73402249-73402271 AAGGGGAGGGAGAAGGGGCAGGG + Intergenic
1026828916 7:73600007-73600029 AAGGGGAGCCACCAGGGGGTGGG - Intronic
1026837259 7:73647375-73647397 AGGGAGAGCCAGAGGGAGGAAGG + Intergenic
1027102175 7:75383213-75383235 AAGGGGAGGGAGAAGGGGCAGGG - Intergenic
1027217228 7:76191872-76191894 GTGGGGAGCCACAAGATGGAAGG - Intergenic
1027397147 7:77767780-77767802 AGGGGGAGGGAGAAGGGGGAGGG - Intronic
1027408103 7:77884388-77884410 ATGGAGACTCAGAAGGGGTAGGG - Intronic
1027521647 7:79216271-79216293 ATGAGGAGCTACAAAGGGGATGG - Intronic
1027609709 7:80345459-80345481 ATGGAGACTCAGAAGGTGGAGGG + Intergenic
1027706143 7:81535912-81535934 ATGGGGAGCAGGAAAGGGGATGG - Intergenic
1027708518 7:81567163-81567185 ATGGGGAGCGGGAAAGGGGATGG - Intergenic
1027932281 7:84552779-84552801 TCCGGGAGCCAGAAGGGGGATGG - Intergenic
1028123910 7:87089354-87089376 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
1028427536 7:90706968-90706990 ATGGGGAGGCAGGACAGGGAGGG - Intronic
1028531394 7:91842372-91842394 AAGGGGAGCTGGAAAGGGGATGG - Intronic
1028761112 7:94497349-94497371 ATAGGGAGCTGGAAAGGGGATGG + Intergenic
1028872287 7:95782799-95782821 ATGGGGAGCTGGAAAGGGGATGG + Intronic
1029016118 7:97316772-97316794 ACGGGGAGCTGGAAAGGGGATGG - Intergenic
1029017277 7:97327507-97327529 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1029033216 7:97490597-97490619 TGCGGGAGCCAGAAGGGAGATGG - Intergenic
1029412873 7:100426927-100426949 AAGGGGAGGGAGGAGGGGGAGGG - Intronic
1029524351 7:101085969-101085991 AGGGTGAGCCAGCAGCGGGAAGG + Intronic
1029541428 7:101184833-101184855 ATGGGGTGTGATAAGGGGGATGG - Intergenic
1029611601 7:101629567-101629589 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1029619534 7:101681309-101681331 GAGGGAAGCCAGGAGGGGGACGG - Intergenic
1029739665 7:102484073-102484095 ACGGGGAGGGAGAAGGTGGAAGG - Intronic
1029757666 7:102583252-102583274 ACGGGGAGGGAGAAGGTGGAAGG - Intronic
1029775602 7:102682313-102682335 ACGGGGAGGGAGAAGGTGGAAGG - Intergenic
1029910215 7:104137765-104137787 TTGGGGAGCCCGAAGGAGGATGG - Intronic
1029945625 7:104529739-104529761 ATGGTGAGTCAGAACAGGGATGG + Intronic
1030021424 7:105278747-105278769 AGGGGAAGGCAGAAGGCGGAAGG + Intronic
1030386553 7:108874216-108874238 ATGGGGAGCTGTAAAGGGGATGG - Intergenic
1030387166 7:108878209-108878231 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1030746563 7:113173039-113173061 TGGGGAAGCCAGAAGGGGAATGG - Intergenic
1030762605 7:113370015-113370037 GTGAGGAGCCAGGAAGGGGAGGG - Intergenic
1030794414 7:113770292-113770314 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1030900024 7:115111873-115111895 ATGGGGACCCACAATTGGGAAGG + Intergenic
1031232308 7:119123647-119123669 ATGGGGAGCCAGCAGGGGGATGG - Intergenic
1031693444 7:124818730-124818752 GTGGGGAACTGGAAGGGGGATGG - Intergenic
1031712651 7:125068270-125068292 GTGGGGAGCTGGAAAGGGGATGG + Intergenic
1031765640 7:125773358-125773380 ATAGGGAGCCAGCAGGGGGATGG - Intergenic
1032544993 7:132734370-132734392 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1032612475 7:133430144-133430166 ATGGGGAGCTGGAAAGGAGATGG + Intronic
1032850899 7:135794225-135794247 ATTGGGAGCAAGAGGGGGAAAGG - Intergenic
1032943685 7:136825226-136825248 ATGCGGCGGCAGAAGGGAGATGG + Intergenic
1033234423 7:139626830-139626852 AAGGGGAGCCAGGAGAGGGGAGG - Intronic
1033418502 7:141185376-141185398 TGAGGGAGCCAGAAGGGAGATGG + Intronic
1033767093 7:144505844-144505866 ATGGGGAGCTGGAAAGGGGATGG - Intronic
1033804392 7:144937599-144937621 AAGGGGAAGCAGAAAGGGGAAGG - Intergenic
1033881302 7:145887155-145887177 ATGGTGAGCTAGAAAGGGGATGG + Intergenic
1033976046 7:147101647-147101669 ATGGGGAGCTGGAAAGGAGATGG + Intronic
1034099272 7:148437308-148437330 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1034119201 7:148611529-148611551 ATGGGGAGCCGGAAGTTGAAGGG - Intronic
1034263825 7:149772306-149772328 CTGGGGAGACAGAGGGGGAAGGG - Intronic
1034424916 7:151009351-151009373 ATGGGGAGTCAGAGAGGGGTGGG - Intronic
1034627055 7:152501780-152501802 ATGGGGACCCAGAGAAGGGAGGG - Intergenic
1034763596 7:153696467-153696489 TGGGGAGGCCAGAAGGGGGATGG - Intergenic
1034931301 7:155166005-155166027 CTGGGGAGCCAGAAGGGGGATGG - Intergenic
1035111228 7:156483713-156483735 AGGGGGAGACAGGAGGGGGAGGG + Intergenic
1035138666 7:156734479-156734501 ATGGAGAGTCAGAAGGGAGAGGG + Intronic
1035268320 7:157704578-157704600 GTGGGGAGCCAGGAGGTGGTAGG - Intronic
1035370346 7:158375868-158375890 ATGGGGAGCTGGAGAGGGGATGG - Intronic
1035574577 8:696546-696568 ATGGGGAGGAAGGAGAGGGAGGG - Intronic
1035574655 8:696894-696916 ATGGGGAGGAAGGAGAGGGAGGG - Intronic
1035824397 8:2629083-2629105 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1036101017 8:5785222-5785244 ATGTGTACCCAGAAGTGGGATGG + Intergenic
1036101859 8:5795690-5795712 ATGGGGAGAGAGAAGGGGGATGG - Intergenic
1036191855 8:6678183-6678205 ATGGGGAGAGAGGTGGGGGAAGG - Intergenic
1036463493 8:8974735-8974757 TTGGGGAGGGTGAAGGGGGAGGG - Intergenic
1036576805 8:10035152-10035174 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1036854201 8:12228398-12228420 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1037175889 8:15945438-15945460 ATGGGGAGCTAGAAGGGGGATGG - Intergenic
1037226783 8:16602235-16602257 ATCGGGAGCCAGGAGGGGGATGG - Intergenic
1037710896 8:21354758-21354780 AAGAAGAGCCAGAAGGGTGAAGG - Intergenic
1037876392 8:22551002-22551024 ATGGGGAGCCGGAAGGGCCGGGG + Intronic
1038115235 8:24546459-24546481 ATGGGGTGCCTGAAGAGGAATGG + Intergenic
1038134832 8:24773884-24773906 AAGGGGAGGGAGAAAGGGGAGGG + Intergenic
1038248595 8:25881927-25881949 TAAGGGAGCCAGAAGGGAGATGG - Intronic
1038301173 8:26350506-26350528 CTGGGGAGGCTGAAGTGGGAAGG - Intronic
1038570467 8:28657918-28657940 ATGGGAAGGCAGAAAGAGGAAGG - Intronic
1038862381 8:31401625-31401647 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1039086315 8:33783604-33783626 TGGGGGAGCCAGAAGGGGGATGG + Intergenic
1039103977 8:33970609-33970631 ATGGGGAGCTGGAGAGGGGATGG + Intergenic
1039290443 8:36088867-36088889 ATGGGGAGCTAGAAAGGGGATGG + Intergenic
1039306334 8:36267336-36267358 ATGAGGAGCTGGAAAGGGGATGG + Intergenic
1039514544 8:38120956-38120978 ATGGGTAGCCATGAGGGGGAAGG - Exonic
1039669975 8:39584770-39584792 ATGGGATCCCAGAAGGGAGAGGG - Intronic
1039679082 8:39709196-39709218 AAGGGGAGCCGAAAAGGGGATGG + Intronic
1039693194 8:39882981-39883003 GTGGGGATCCATAATGGGGATGG + Intergenic
1040005390 8:42616635-42616657 ATGGAGAGCCAGATGGGAGTGGG - Intergenic
1040602361 8:48897362-48897384 ATGGGGAGCAAGAAGGGGGATGG + Intergenic
1040835036 8:51722587-51722609 ATAGGGAGCTGGAAAGGGGATGG + Intronic
1041201979 8:55458624-55458646 ATGGGGAGCTGGAAAGGGAATGG + Intronic
1041312353 8:56529762-56529784 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1041918302 8:63157864-63157886 ATGGGGAGTCAGAAAGGGGATGG + Intergenic
1041934719 8:63322440-63322462 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1042159217 8:65875106-65875128 ATGGGGATCCAGAAGCAGGATGG + Intergenic
1042224375 8:66504125-66504147 GTGGGGAGGGAGAATGGGGAGGG - Intronic
1042238696 8:66640780-66640802 GTGGGGAGCTGGAAAGGGGATGG - Intronic
1042598198 8:70471749-70471771 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1042784496 8:72533329-72533351 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1042984371 8:74566688-74566710 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
1043148416 8:76682892-76682914 AAGAGGAGCGAGAAGGGGGTTGG - Intronic
1043220454 8:77655814-77655836 TTGGGGAGCTGGAAAGGGGATGG - Intergenic
1043238457 8:77899699-77899721 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1043257031 8:78150090-78150112 GTGGGGATCCATAATGGGGATGG - Intergenic
1043599806 8:81923583-81923605 ATGAGGAGCCCCAAGGGGGATGG - Intergenic
1043605284 8:81991723-81991745 TGGGGAAGCCAGAAGGGAGATGG + Intergenic
1043815108 8:84792279-84792301 ATGGGGAGATGGAAGGGGGATGG + Intronic
1043999786 8:86865442-86865464 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1044085340 8:87936428-87936450 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1044206203 8:89494331-89494353 ACGGGGAGCCAGAAGGGAGATGG - Intergenic
1044274660 8:90285681-90285703 ATGGGGAGCTGAAAAGGGGATGG + Intergenic
1044489340 8:92793577-92793599 CTGGGGAGCCAGACTAGGGATGG + Intergenic
1044621554 8:94195592-94195614 ATGGGAAGCCTTAAGGAGGAAGG - Intronic
1045355920 8:101388996-101389018 ATGGGGACAGAGAAGGAGGATGG - Intergenic
1045542646 8:103101320-103101342 ATGGGCAGCCAGACTGAGGAGGG + Intergenic
1045861522 8:106819235-106819257 TGGGGGAGCCAGAAGGGAGACGG - Intergenic
1045938499 8:107710982-107711004 TGGGGGAGTCAGAAGGGAGATGG + Intergenic
1045942513 8:107755420-107755442 ATGGGAAGCCAGAAGGGAGATGG - Intergenic
1046138915 8:110064051-110064073 TGGGGGAGCCAGAAGGGAAATGG - Intergenic
1046142709 8:110115894-110115916 TGGGGAAGCCAGAAGGGAGATGG - Intergenic
1046174683 8:110560050-110560072 ATGGGGAGCCAGAAGGTGGAGGG + Intergenic
1046277442 8:111982237-111982259 ATGGGGAGCCAGAAGGGAGATGG + Intergenic
1046439218 8:114236628-114236650 TATGGGAGCCAGAAGGGGAACGG - Intergenic
1046582522 8:116110870-116110892 ATGGGGAGCTAGAAAGGGGATGG - Intergenic
1046779622 8:118201233-118201255 ATGCAGAGCCAGAAGGAGGCTGG - Intronic
1046870163 8:119197120-119197142 TGGGGGAGCCAGAAGGGAGATGG + Intronic
1047113788 8:121818524-121818546 ATGGGGAGCAGGAAAGGGGATGG - Intergenic
1047202103 8:122775977-122775999 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1047203695 8:122786700-122786722 GGGGGGAGGCAGAAGGGGAATGG - Intronic
1047255258 8:123209110-123209132 CTGGGGAGCCAGAGGGGAGCAGG + Exonic
1047406028 8:124586528-124586550 CTGGGGAGCTTGTAGGGGGAGGG - Intronic
1047542607 8:125785030-125785052 TGGGGGAGCAAGAAGGGAGATGG - Intergenic
1047586521 8:126279690-126279712 ATGGGGAGCCAGAAGGGAGATGG - Intergenic
1047883156 8:129218586-129218608 ATGGGGAGCCAAAAGGGGAATGG - Intergenic
1048123507 8:131607786-131607808 ACAGGGAGCCAGAAGGGGAATGG + Intergenic
1048135036 8:131740118-131740140 TGGGAGAGCCAGAAGGGAGATGG - Intergenic
1048439603 8:134450305-134450327 AAGGGGAGCTAAAAAGGGGATGG - Intergenic
1048561376 8:135541306-135541328 ATGGGGAGCAAGAATGGGACTGG - Intronic
1048623391 8:136159142-136159164 ATAGGGAACCATAAGGGGAATGG + Intergenic
1048648699 8:136450945-136450967 ATGGGGAGTTGGAAGGGGGATGG + Intergenic
1048671717 8:136730290-136730312 ATGGCAGGCCAGAAGCGGGATGG + Intergenic
1048680101 8:136831855-136831877 ATGAGGAGCTGGAAAGGGGATGG + Intergenic
1048879166 8:138859016-138859038 CTGGGGACCGAGAAGGGAGATGG - Intronic
1048900364 8:139031737-139031759 ATGGGGAGCTGGAAAGGGGAAGG + Intergenic
1049083131 8:140457910-140457932 ATGGGGAGGGAGGAGGAGGAGGG + Intronic
1049269658 8:141687563-141687585 ATGAGGAGGCAGGAGGGGCAGGG + Intergenic
1049451542 8:142664706-142664728 GAAGGGAGGCAGAAGGGGGACGG - Exonic
1049726981 8:144151503-144151525 TGGGGGAGCCAGAAAGGAGATGG - Intronic
1049998762 9:1053658-1053680 AATGGGGGCGAGAAGGGGGAAGG - Intronic
1050043620 9:1521102-1521124 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1050342485 9:4654643-4654665 TGGGGGAGCCAGCAGGGAGATGG + Intronic
1050479300 9:6073393-6073415 TCGGGGAGTCAGAAGGGAGACGG - Intergenic
1050772807 9:9224308-9224330 ATGGGGAGGGAGAAAGGGAAAGG + Intronic
1050829109 9:9989531-9989553 AAGGGGAGCTAGAAGGGGGATGG - Intronic
1050900839 9:10947133-10947155 GCGGGGAGCCAGAAGGGAAATGG + Intergenic
1051103580 9:13550957-13550979 TGGGGCAGCCAGAAGGGAGATGG + Intergenic
1051263471 9:15288534-15288556 ATGGGGAGCTGGAAGGGGGATGG - Intronic
1051724881 9:20078635-20078657 AGGAGTAGCCAGAAGGGAGATGG - Intergenic
1051735884 9:20198690-20198712 TTGGGGAGAGAGAAGGGGGTGGG - Intergenic
1051887167 9:21905266-21905288 GTGGTGAGCCAGAAGGGGAATGG + Intronic
1052459747 9:28747319-28747341 ATGAGGAGCTGGAAGGGGAATGG - Intergenic
1052551488 9:29955834-29955856 ATGGAGACTCAGAATGGGGAGGG - Intergenic
1052768674 9:32667751-32667773 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1052778402 9:32755813-32755835 GCGGGGAGCCAGAAGGGAGATGG + Intergenic
1052793653 9:32902287-32902309 GTGGGGAGCTAGAAGGGGGATGG - Intergenic
1053107380 9:35422982-35423004 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1053124904 9:35573014-35573036 ATGGAGAGACAGAAAGGGGGAGG + Intergenic
1053357071 9:37455321-37455343 ATGGGGAGCTGGAAAGGGGATGG - Intronic
1053428714 9:38027835-38027857 CTGGGGAGGCAGAAGGGACAGGG + Intronic
1053487411 9:38470431-38470453 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1053525511 9:38826230-38826252 GAGGGGAGCCAGAGGGGGGATGG - Intergenic
1054197740 9:62050657-62050679 GAGGGGAGCCAGAGGGGGGATGG - Intergenic
1054353444 9:64040613-64040635 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1054640614 9:67537715-67537737 GAGGGGAGCCAGAGGGGGGATGG + Intergenic
1054793867 9:69280590-69280612 GATGGAAGCCAGAAGGGGGAAGG - Intergenic
1055053379 9:72001290-72001312 AAGGGGATGCAGAAGGAGGATGG + Intergenic
1055121382 9:72664694-72664716 GTGGGGAGCTGGAAAGGGGATGG - Intronic
1055356509 9:75443059-75443081 TTGGGGAGCCAGAAAGGAGATGG + Intergenic
1055449277 9:76416268-76416290 ATGGGCAGCTGGAAAGGGGATGG - Intergenic
1055486281 9:76759605-76759627 ATGGGGAGCTGGAAAGGGAATGG - Intronic
1055708467 9:79033671-79033693 GTGGGGAGCTAGAGAGGGGATGG + Intergenic
1055869337 9:80855336-80855358 ATGGGGAGCCGGAAAGGGGATGG + Intergenic
1056014026 9:82363316-82363338 CAGGGGTGCCAGAAGAGGGAGGG + Intergenic
1056085729 9:83147814-83147836 AGGGGGAGCTGGAAAGGGGATGG + Intergenic
1056327355 9:85490915-85490937 ATGGGGAGCCAGAAGGAGGATGG - Intergenic
1056782798 9:89563978-89564000 TTTAGGAGCCAAAAGGGGGAGGG + Intergenic
1056844252 9:90023772-90023794 TTGGGCTGCCAGGAGGGGGACGG - Intergenic
1056871905 9:90289626-90289648 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1057231547 9:93324535-93324557 ATGGGGAGGCTGGAGGGGGATGG - Intronic
1057236542 9:93366082-93366104 ATGGGGAGGCTGGAGGGGGATGG + Intergenic
1057914361 9:99044263-99044285 AGTGGGAGCCTGAAGGGGCATGG + Intronic
1058030011 9:100185707-100185729 TTGGGGACTCAGAAAGGGGAAGG - Intronic
1058093856 9:100836984-100837006 ATGGGCAGCTGGAAGGGGGATGG - Intergenic
1058236598 9:102498123-102498145 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1058311933 9:103514845-103514867 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1058321432 9:103636360-103636382 ATGGGGAGCTGGAAAAGGGATGG - Intergenic
1058584468 9:106492243-106492265 TGGGGGAGCCAGAAGGGAAATGG + Intergenic
1059042495 9:110829909-110829931 TGGCGGAGCCAGAAGGGAGACGG - Intergenic
1059042603 9:110830565-110830587 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1059062225 9:111045355-111045377 AAGGGGAGCTGGAAAGGGGATGG - Intergenic
1059476427 9:114551500-114551522 CTTGGGAGGCTGAAGGGGGAGGG - Intergenic
1059573808 9:115468545-115468567 ATAGGGAGCTGGAAAGGGGATGG + Intergenic
1059844536 9:118259911-118259933 TTAGGGAGCAAGAAGAGGGAGGG - Intergenic
1059930469 9:119255403-119255425 TGGGGGAGCCAGAGGTGGGAGGG + Intronic
1059949275 9:119445215-119445237 AGGGGGAGGGGGAAGGGGGAGGG - Intergenic
1059952226 9:119477705-119477727 ATGCGGAGCCAGAAGGGGGATGG + Intergenic
1060034640 9:120244242-120244264 ATGGACAGCCAGAAGGTGCATGG - Intergenic
1060791693 9:126489656-126489678 ATGGGGAGCCAGCAGGGTGACGG - Intronic
1060892398 9:127197080-127197102 ATGGGAAGCTAGAAGGAGGGAGG + Intronic
1061074805 9:128334607-128334629 ATGGGGACTCAGAGAGGGGAAGG - Intergenic
1061190692 9:129081076-129081098 ATGGGGAGCCAGGGGGGCGGTGG - Intergenic
1061246048 9:129401748-129401770 AGGGGGAGGGAGAAGGGGGGAGG - Intergenic
1061490601 9:130941905-130941927 TTGGTGAGCCAGAAAGAGGAAGG - Intergenic
1061500355 9:130998198-130998220 ATGGGGAGCCCAAAGGGGGAAGG - Intergenic
1061637473 9:131922022-131922044 ATGGGGAGGGGGGAGGGGGAGGG + Intronic
1062527072 9:136982282-136982304 ACAGGGAGCCAGAAGGGATATGG - Intronic
1203695907 Un_GL000214v1:96717-96739 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1203741777 Un_GL000218v1:9723-9745 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1203701966 Un_KI270742v1:4313-4335 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1203553949 Un_KI270743v1:190368-190390 ATGGGAAGCTGGAAAGGGGATGG + Intergenic
1203640366 Un_KI270751v1:7346-7368 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1185459839 X:328886-328908 AGGGGGAGAGAGGAGGGGGAGGG - Intergenic
1185508274 X:644484-644506 ATGGGCAGCCCGAAGGGCGGCGG - Exonic
1185738502 X:2511776-2511798 ATGGGGAGCTGGAAAGGGAATGG + Intergenic
1185796716 X:2971851-2971873 ATGGGGAGTTGGAAAGGGGACGG + Intergenic
1185803289 X:3032598-3032620 AGGGAGAGACAGAAGAGGGAGGG + Intronic
1185837749 X:3360948-3360970 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1185942865 X:4340803-4340825 TGGGGGAGCCAGCAGGGAGATGG + Intergenic
1185950106 X:4423043-4423065 AAGGGGAGCTGGAAGTGGGATGG + Intergenic
1186036474 X:5428882-5428904 ATGGGGAGCCGGAAAGGGGATGG + Intergenic
1186056473 X:5654707-5654729 ATGGGGAGCTGGAGAGGGGATGG + Intergenic
1186286230 X:8046718-8046740 ATGGGGAGCCAGAAAGGGGATGG + Intergenic
1187097280 X:16161906-16161928 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1187138524 X:16571154-16571176 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1187485552 X:19699783-19699805 ATGGGGTGCAAGAAGGGGTGGGG - Intronic
1187607816 X:20905626-20905648 ATGGGGAGCCTGCAGGGGTTGGG + Intergenic
1187775426 X:22751242-22751264 AGAGGGAGCAAGAAAGGGGAGGG + Intergenic
1187885291 X:23883498-23883520 AAACGGAGCCAGAAGGGGTATGG - Intronic
1187943404 X:24403119-24403141 ATGGGGAGGGGGCAGGGGGAGGG - Intergenic
1187960441 X:24562400-24562422 ATGGGGAGCGGGAAGGGGACCGG + Exonic
1188158741 X:26774966-26774988 ATGGAGACTCAGAAAGGGGAAGG + Intergenic
1188390359 X:29611817-29611839 ATGGGGAGCTCGAAAGGGTATGG + Intronic
1188437561 X:30179662-30179684 ATGGGGAGCTTGAAAGGGGATGG - Intergenic
1188526567 X:31094106-31094128 ATGGGGAGCTGGAAAGGAGATGG + Intergenic
1188699771 X:33243870-33243892 ATGGGGAATCAGAAGGGTGGAGG + Intronic
1188807101 X:34605066-34605088 ATGGGGAGCTGGAAGTGGGATGG - Intergenic
1189450303 X:41122804-41122826 ATGGGGAGCTGGAGAGGGGATGG + Intronic
1189496890 X:41516669-41516691 ATAGGAAGCAAGAAGGAGGAGGG + Intronic
1189837332 X:45039210-45039232 ATGGGGAGGCAGAGGGGGGATGG - Intronic
1189935363 X:46062506-46062528 CTGGGGAGCAGGAATGGGGAAGG - Intergenic
1189959065 X:46307555-46307577 TGGGAGAGCCAGAAGGGAGATGG + Intergenic
1190160919 X:48030782-48030804 AAGGGGAGCCAAAGGGAGGAAGG + Intronic
1190569375 X:51766173-51766195 CTGGGGAGCTGGAAAGGGGATGG - Intergenic
1190600822 X:52089973-52089995 ATGGGGAGCCAAAAGGGGAATGG - Intergenic
1190619076 X:52266989-52267011 AAGGGGAGCCAGAGGGAGGAAGG + Intergenic
1190631293 X:52389432-52389454 ATGGGGAGCTAGAAGGTGGAGGG + Intergenic
1190637099 X:52446146-52446168 AAGGGGAGCCAGAGGGAGGAAGG - Intergenic
1191016237 X:55813310-55813332 CCGGGGAGCCAGCAGGGGGCTGG + Intergenic
1191052963 X:56213969-56213991 AAGGGGAGCTAGAAAGGGGATGG + Intergenic
1191146047 X:57166185-57166207 ATGGAAAGCCAGAGGGGGGATGG - Intergenic
1191767117 X:64710013-64710035 AAGGGGAGCTGGAAGGGGGATGG + Intergenic
1191974902 X:66861309-66861331 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1192049627 X:67712212-67712234 ATTGAGACCCAGAAGGGGAAGGG - Intronic
1192098515 X:68239071-68239093 ATGGGGAGCCAGAAGGAGGATGG + Intronic
1192390400 X:70720368-70720390 ATGGGGTGGGAGAAGGGGGTAGG + Intronic
1193144600 X:78064059-78064081 AAGGGGAGCTGAAAGGGGGATGG + Intergenic
1193183624 X:78486896-78486918 TAGGGGAGCCAGAAGAGAGATGG + Intergenic
1193322032 X:80134062-80134084 ATGGGGAGCTAAAAGGGGAATGG - Intergenic
1193358422 X:80551155-80551177 TCGGGGAGCCAGAAGGGAGATGG + Intergenic
1193416378 X:81229529-81229551 TTGGGGAGCCAGAAGGGAGATGG + Intronic
1193470943 X:81902571-81902593 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
1193511046 X:82400171-82400193 ACTGGAAGCCAGAAGGGGCACGG + Intergenic
1193656256 X:84201637-84201659 ATGGGAAGGCAGAAGTGGGAGGG - Intergenic
1193702468 X:84779913-84779935 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1193709374 X:84860770-84860792 ATGGAGAGCTGGAAAGGGGATGG - Intergenic
1193836339 X:86349181-86349203 TGGGGAGGCCAGAAGGGGGATGG + Intronic
1193898240 X:87141118-87141140 TGAGGGAGCCAGAAGGGAGATGG - Intergenic
1194119463 X:89942998-89943020 ATGGGGAGCTGGAAGGTGGAGGG - Intergenic
1194752151 X:97697178-97697200 ATGGGGAGCTAGACAAGGGATGG - Intergenic
1194763076 X:97816994-97817016 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1194859560 X:98980032-98980054 TGGGGAGGCCAGAAGGGGGATGG - Intergenic
1194979173 X:100423028-100423050 GTGGGGAGCTAGAAAGGGAATGG + Intergenic
1195010283 X:100726931-100726953 ATGGAGACTCAGAAGGGTGAGGG - Intronic
1195367292 X:104138711-104138733 CGGGGGAACCAGAAGGGAGATGG + Intronic
1195858765 X:109358480-109358502 AAGGGGAGCTGGAAGAGGGATGG - Intergenic
1196072302 X:111539336-111539358 TGGGGGAACCAGAAGGGAGATGG - Intergenic
1196203648 X:112914524-112914546 ATGGGGTGGAGGAAGGGGGAGGG - Intergenic
1196242066 X:113353424-113353446 TGGGGGAGCCAGAAGGGGGATGG - Intergenic
1196261398 X:113586386-113586408 TGGTGGAGCCAGAAGGGAGATGG + Intergenic
1196271419 X:113716342-113716364 ATGGGGAACCGGAAGGGGAATGG - Intergenic
1196395906 X:115261479-115261501 ATGGGGAGTTAAAAAGGGGATGG + Intergenic
1196861564 X:120033664-120033686 ATGGGGAGCTGGAAAGGGAATGG - Intergenic
1197340695 X:125263314-125263336 ATGGGGAGCTGTAAAGGGGATGG + Intergenic
1197462094 X:126755318-126755340 AAGGGGAGCTAGAAAGGGGATGG + Intergenic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1197666394 X:129228708-129228730 CTGGGAAGCCAGAGGTGGGATGG - Intergenic
1197748283 X:129947651-129947673 ATAGGGAGCCAGTGAGGGGATGG - Intergenic
1198134421 X:133733273-133733295 TTAGGGACTCAGAAGGGGGAGGG + Intronic
1198147034 X:133867950-133867972 ACGGGGAGCTGGAAAGGGGATGG - Intronic
1198271000 X:135055925-135055947 TTGGGGAGCCAGATAGGAGATGG - Intergenic
1198417189 X:136432612-136432634 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1198697653 X:139359736-139359758 ATGAAGAGCTGGAAGGGGGACGG + Intergenic
1198883409 X:141306528-141306550 ATGGGGAGCCAGAAAGGAGATGG - Intergenic
1198964274 X:142210757-142210779 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1199078384 X:143549565-143549587 ATGAGGAGCCAGGAGGTAGAGGG + Intergenic
1199142628 X:144331436-144331458 CGGGGGAGCCAGAAGGGAGATGG + Intergenic
1199143309 X:144335917-144335939 TGAGGGAGCCAGAAGGGAGATGG + Intergenic
1199380654 X:147168475-147168497 ATGGGGAGCTGGAAAGGAGATGG - Intergenic
1199432437 X:147776559-147776581 AAGGGAAGCTAGAAGGGGGATGG + Intergenic
1199575688 X:149311748-149311770 ATGGGGAACTGGAAAGGGGATGG + Intergenic
1199794238 X:151179468-151179490 AGGGGGAGGGAGAAGGAGGAGGG - Intronic
1199966786 X:152826817-152826839 GTGGGGAGGCAGAAGGGGTGAGG - Intergenic
1200010001 X:153113745-153113767 TTTGAGAACCAGAAGGGGGAAGG - Intergenic
1200029599 X:153286177-153286199 TTTGAGAACCAGAAGGGGGAAGG + Intergenic
1200102261 X:153694037-153694059 ACAGGGAGCCAGGAGGGGGGCGG + Intronic
1200165577 X:154032939-154032961 AAAGGGAGCCAAATGGGGGAGGG + Intronic
1200371714 X:155733017-155733039 GTGGGGAGAGAGAAGGGGAATGG + Intergenic
1200472336 Y:3600555-3600577 ATGGGGAGCTGGAAGGTGGAGGG - Intergenic
1200491400 Y:3827990-3828012 TTGGAGATTCAGAAGGGGGAAGG + Intergenic
1200690383 Y:6303074-6303096 ATGGGGACCCACAAGGGAGATGG + Intergenic
1200710125 Y:6475873-6475895 ATGGGGAGCCAGAATGGAGATGG + Intergenic
1200883074 Y:8240962-8240984 ATGGGGAGCCAGAAGGGAGATGG + Intergenic
1200910060 Y:8523971-8523993 ATGGGGAGCCAGAAGGAAGATGG - Intergenic
1200940573 Y:8775978-8776000 ATGGGGAGCCAGAAGGGAGATGG + Intergenic
1200955187 Y:8937524-8937546 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1200960203 Y:8989482-8989504 ATGGAGAGCCAGAAGGGAGATGG - Intergenic
1200985270 Y:9296841-9296863 ATGGGGAGCTAGAAAGGAGATGG + Intergenic
1201023990 Y:9688835-9688857 ATGGGGAGCCAGAATGGAGATGG - Intergenic
1201044890 Y:9871642-9871664 ATGGGGACCCACAAGGGAGATGG - Intergenic
1201155309 Y:11127177-11127199 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1201300732 Y:12502559-12502581 TTGGGGAGCTGGAAAGGGGATGG - Intergenic
1201339822 Y:12922726-12922748 ATAGGGAGCCAGAAAGGGGATGG + Intergenic
1201340344 Y:12926352-12926374 GTGGGGAGCCAGAAGGGCGATGG + Intergenic
1201455089 Y:14160747-14160769 GTGGGGATCCATATGGGGGAAGG - Intergenic
1201547716 Y:15184253-15184275 ATGGGTAGCTGGAAAGGGGATGG - Intergenic
1201634301 Y:16105092-16105114 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1201695339 Y:16818278-16818300 ATGGGGACTTAGAAGGCGGATGG + Intergenic
1201727786 Y:17172570-17172592 TTTGGGAGCCAGAAGGGAGATGG + Intergenic
1201751498 Y:17436650-17436672 ATGGGGAGATGGAAAGGGGATGG + Intergenic
1202107191 Y:21384020-21384042 ATGGTGAGCCAGAAGGGAGATGG + Intronic
1202111115 Y:21421701-21421723 ATGGGGACCCAGAAGGCAGATGG + Intergenic
1202117356 Y:21482454-21482476 ATGGGGACCCAGAAGGGAAATGG - Intergenic
1202183592 Y:22160047-22160069 ATGGGGAGCCAGAATGGAGATGG + Intergenic
1202200009 Y:22336240-22336262 ATGGGGAGCCAGAAGGGAGATGG - Intronic
1202207767 Y:22426354-22426376 ATGGGGAGCCAGAATGGAGATGG - Intergenic
1202233324 Y:22678768-22678790 ATGGGGAGCCAGAAGGGAGACGG - Intergenic
1202309832 Y:23517390-23517412 ATGGGGAGCCAGAAGGGAGACGG + Intergenic
1202560969 Y:26153203-26153225 ATGGGGAGCCAGAAGGGAGACGG - Intergenic