ID: 935139315

View in Genome Browser
Species Human (GRCh38)
Location 2:100338683-100338705
Sequence CTCTTTCTGGGATGTGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935139309_935139315 -4 Left 935139309 2:100338664-100338686 CCTTTCCCTTCCTTCTCAACTCT No data
Right 935139315 2:100338683-100338705 CTCTTTCTGGGATGTGTGTCTGG No data
935139310_935139315 -9 Left 935139310 2:100338669-100338691 CCCTTCCTTCTCAACTCTTTCTG No data
Right 935139315 2:100338683-100338705 CTCTTTCTGGGATGTGTGTCTGG No data
935139311_935139315 -10 Left 935139311 2:100338670-100338692 CCTTCCTTCTCAACTCTTTCTGG No data
Right 935139315 2:100338683-100338705 CTCTTTCTGGGATGTGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935139315 Original CRISPR CTCTTTCTGGGATGTGTGTC TGG Intergenic
No off target data available for this crispr