ID: 935140774

View in Genome Browser
Species Human (GRCh38)
Location 2:100350990-100351012
Sequence CACAGTTACCACCTACATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935140772_935140774 -1 Left 935140772 2:100350968-100350990 CCAACTGGAGGAATAAAGGGAAC No data
Right 935140774 2:100350990-100351012 CACAGTTACCACCTACATGGAGG No data
935140767_935140774 15 Left 935140767 2:100350952-100350974 CCAAAGGAGCAGTGAGCCAACTG No data
Right 935140774 2:100350990-100351012 CACAGTTACCACCTACATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935140774 Original CRISPR CACAGTTACCACCTACATGG AGG Intergenic
No off target data available for this crispr