ID: 935141914

View in Genome Browser
Species Human (GRCh38)
Location 2:100360864-100360886
Sequence GGGGCCACACATGTTTAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935141914_935141920 -2 Left 935141914 2:100360864-100360886 CCATGTTAAACATGTGTGGCCCC No data
Right 935141920 2:100360885-100360907 CCCGGGTAGCCTTTTCCTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935141914 Original CRISPR GGGGCCACACATGTTTAACA TGG (reversed) Intergenic
No off target data available for this crispr