ID: 935142845

View in Genome Browser
Species Human (GRCh38)
Location 2:100369149-100369171
Sequence ATTTTTAAGGGGATTATGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935142834_935142845 13 Left 935142834 2:100369113-100369135 CCTCAAATCCATCTCCCTGAGGA No data
Right 935142845 2:100369149-100369171 ATTTTTAAGGGGATTATGAAGGG No data
935142832_935142845 14 Left 935142832 2:100369112-100369134 CCCTCAAATCCATCTCCCTGAGG No data
Right 935142845 2:100369149-100369171 ATTTTTAAGGGGATTATGAAGGG No data
935142839_935142845 -1 Left 935142839 2:100369127-100369149 CCCTGAGGAGTTCTGGTCTGGGA No data
Right 935142845 2:100369149-100369171 ATTTTTAAGGGGATTATGAAGGG No data
935142836_935142845 5 Left 935142836 2:100369121-100369143 CCATCTCCCTGAGGAGTTCTGGT No data
Right 935142845 2:100369149-100369171 ATTTTTAAGGGGATTATGAAGGG No data
935142840_935142845 -2 Left 935142840 2:100369128-100369150 CCTGAGGAGTTCTGGTCTGGGAT No data
Right 935142845 2:100369149-100369171 ATTTTTAAGGGGATTATGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935142845 Original CRISPR ATTTTTAAGGGGATTATGAA GGG Intergenic
No off target data available for this crispr