ID: 935143607

View in Genome Browser
Species Human (GRCh38)
Location 2:100378026-100378048
Sequence AGGGAGAAACAGAAAGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935143607_935143612 6 Left 935143607 2:100378026-100378048 CCTACCTCTTTCTGTTTCTCCCT No data
Right 935143612 2:100378055-100378077 TGTGGCACATTCAGTGCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935143607 Original CRISPR AGGGAGAAACAGAAAGAGGT AGG (reversed) Intergenic
No off target data available for this crispr