ID: 935146598

View in Genome Browser
Species Human (GRCh38)
Location 2:100399676-100399698
Sequence CCCACCCAGCTCTTCCTTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 240}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935146591_935146598 -10 Left 935146591 2:100399663-100399685 CCCCTCAGGGCCCCCCACCCAGC 0: 1
1: 1
2: 4
3: 74
4: 573
Right 935146598 2:100399676-100399698 CCCACCCAGCTCTTCCTTTATGG 0: 1
1: 0
2: 0
3: 19
4: 240
935146590_935146598 -9 Left 935146590 2:100399662-100399684 CCCCCTCAGGGCCCCCCACCCAG 0: 1
1: 1
2: 9
3: 72
4: 659
Right 935146598 2:100399676-100399698 CCCACCCAGCTCTTCCTTTATGG 0: 1
1: 0
2: 0
3: 19
4: 240
935146585_935146598 25 Left 935146585 2:100399628-100399650 CCGGGACGCTGGAACTATCAGGA 0: 1
1: 0
2: 0
3: 2
4: 88
Right 935146598 2:100399676-100399698 CCCACCCAGCTCTTCCTTTATGG 0: 1
1: 0
2: 0
3: 19
4: 240
935146589_935146598 -8 Left 935146589 2:100399661-100399683 CCCCCCTCAGGGCCCCCCACCCA 0: 1
1: 0
2: 10
3: 122
4: 839
Right 935146598 2:100399676-100399698 CCCACCCAGCTCTTCCTTTATGG 0: 1
1: 0
2: 0
3: 19
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935146598 Original CRISPR CCCACCCAGCTCTTCCTTTA TGG Intronic
900643006 1:3696228-3696250 CCTCCCCTGCTCTTCCTCTAAGG - Intronic
901103831 1:6739967-6739989 CCCTACCACCCCTTCCTTTACGG + Intergenic
902849246 1:19140821-19140843 GGCACCCAGCTCTTCCTCTCTGG - Exonic
902932950 1:19744175-19744197 CCCACCCTGCTCTTTTTCTAAGG + Intronic
903478716 1:23637980-23638002 CCCACCCAGCTCTGTCTCTGTGG + Intronic
903974511 1:27140473-27140495 CACCCTCACCTCTTCCTTTAAGG + Intronic
905704605 1:40045418-40045440 CCCACCCAGAAATTCCTTGAAGG - Intronic
905953886 1:41975949-41975971 CCCAGCCAGCACTTCCCTAAGGG + Intronic
907512928 1:54975769-54975791 CCCACCCATCTCCTACCTTAAGG - Intergenic
907522493 1:55033341-55033363 CCAGCCCAGCTCTTCCTTGCAGG + Intergenic
907867280 1:58410405-58410427 CCCACCCACCCCTTTCTTGAAGG + Intronic
909508665 1:76425399-76425421 CACACCAAGCTCTTTTTTTAAGG + Intronic
911848729 1:102787132-102787154 CCCATTCAGATATTCCTTTATGG - Intergenic
912343082 1:108936697-108936719 TCCATCCAGCTAATCCTTTAGGG + Intronic
912670601 1:111620407-111620429 CAAACCCAGCTCTCCCTTTTGGG + Intronic
912901629 1:113656710-113656732 CCCAGCCAGATCATTCTTTATGG + Intronic
916434150 1:164761026-164761048 CCCACCCATCTTTTTCTTTTTGG + Intronic
917723063 1:177804328-177804350 TCCACCCAGCTCTTCGTGTCTGG - Intergenic
918526333 1:185468806-185468828 CCCATCCCACCCTTCCTTTAAGG - Intergenic
919814249 1:201427877-201427899 CCCACCCAGGCCTTCCTGGAGGG - Intronic
920133937 1:203754486-203754508 CCAACCCACCTCTTCCATTAGGG + Intergenic
923276923 1:232404527-232404549 GCCCCTCAGATCTTCCTTTAAGG - Intronic
923321065 1:232833930-232833952 CCCACCCATCTCTTCCCTCCAGG - Intergenic
924589714 1:245392091-245392113 CCCAGAGAGCTCTTCCTTCATGG - Intronic
1069567720 10:69474716-69474738 CCCACCCAGCTCTTCATTCCTGG + Intronic
1070813796 10:79311275-79311297 CCCACCCACCTCCTCCCTTCGGG - Intronic
1071294621 10:84210853-84210875 GCCAACCAGCTATTCCTGTAAGG - Intronic
1072250812 10:93581080-93581102 CCCACGCTGCTCTTCCATTCTGG - Intronic
1072723451 10:97795951-97795973 CTCACCAAGCAATTCCTTTAAGG - Intergenic
1072867345 10:99078186-99078208 CCCAGTCAGCTATTCCTTTATGG + Intronic
1074246648 10:111700807-111700829 CCCATCCTGCTGTTCCCTTAAGG - Intergenic
1074288317 10:112119297-112119319 CCAACCCAGATCTTCCTCTGAGG - Intergenic
1075581427 10:123621556-123621578 ACCACCCAGTTCTTCCCTGAAGG + Intergenic
1075622777 10:123939933-123939955 CCTACCCAGCTCTGCCTGTGTGG - Intronic
1076801452 10:132832423-132832445 CCCACCCAGGTCTTACTCTCTGG - Intronic
1077325596 11:1962642-1962664 CCCACCCAGCTCAGCCTGTCAGG + Intronic
1077674916 11:4187277-4187299 CCCAGCCCGGTCTTCCTCTACGG + Intergenic
1078457677 11:11487988-11488010 CATACCCAGCTGTTCATTTATGG - Intronic
1078735888 11:14020283-14020305 CTCCCCCAGCTCTTCCCTTTGGG - Intronic
1083274855 11:61591082-61591104 CCCATTGACCTCTTCCTTTATGG + Intergenic
1084121444 11:67071414-67071436 CCCATCCACCTCTCCCTCTAGGG + Exonic
1085509851 11:77082688-77082710 CCAGCCGAGCTCTCCCTTTATGG + Intronic
1086398390 11:86440785-86440807 CCCACCCATCTTTTCCTCTTGGG + Intergenic
1086401142 11:86461730-86461752 GCCACCCAGATCCTCCTTCAAGG - Intronic
1087907024 11:103710081-103710103 CCCACCCAGCTCTGCCAGGAAGG + Intergenic
1089150636 11:116361163-116361185 CACACCCAGCTCCTCCATTCCGG + Intergenic
1090088183 11:123669871-123669893 CTCAGCCAGCTCTTCTTTTGTGG - Intergenic
1091030960 11:132187393-132187415 CCCACCCACGTATCCCTTTAGGG + Intronic
1202808576 11_KI270721v1_random:17821-17843 CCCACCCAGCTCAGCCTGTCAGG + Intergenic
1092196302 12:6551590-6551612 CCCACCCAGAGCCTCCTCTAAGG + Intronic
1093426691 12:19035908-19035930 CCCACCCTGTGCTTCCATTAGGG - Intergenic
1095986958 12:48005123-48005145 CCCATCCAGCTCTGCGTTGAAGG + Intergenic
1096694019 12:53337528-53337550 CCCTCCCAGCTCTCCCTGTCAGG + Intronic
1100667370 12:96769576-96769598 CGCAGCCAGCTCTCCCTTCAGGG + Intronic
1103573973 12:121863277-121863299 CCCAGCCAGCTCTGCATTTCTGG + Intronic
1103906591 12:124330818-124330840 CCCATCCAGCCCTTGCTATATGG - Intronic
1105915265 13:24909565-24909587 CCCTGCCAGCTCTTTCTGTATGG - Intronic
1107544050 13:41420510-41420532 CCAACCCAGCTCTTGCATGATGG - Intergenic
1107585349 13:41841173-41841195 CCAATCCAGCTCTTTCCTTATGG - Intronic
1108228736 13:48317237-48317259 TCCACCCAGCTCTTCCATTTTGG - Intronic
1110625449 13:77650340-77650362 CCCAGCCAGATATTTCTTTATGG + Intergenic
1112353993 13:98659586-98659608 CCTTCTCAGCTCTTCCTTCAAGG - Intergenic
1116467164 14:45247539-45247561 CACACCCAGCTCTTTTGTTAAGG - Intronic
1118248204 14:64132598-64132620 CCCAGCCAACTTTTCCTTCAGGG - Intronic
1118455002 14:65937505-65937527 CACCCCAACCTCTTCCTTTATGG + Intergenic
1119530240 14:75354973-75354995 CCCCCCCAGCTCCTCCTGCAGGG + Intergenic
1121985387 14:98500600-98500622 TCCACCCAGCTCTCCCTTCTGGG + Intergenic
1122550323 14:102545664-102545686 CCCACCCCGCTGTTCTTTCAAGG - Intergenic
1122609280 14:102970136-102970158 CCCGCCCAGCACTACCTTGAGGG + Exonic
1127996097 15:64153822-64153844 CCCACTCACCTTTTCCTTCATGG + Intronic
1128390041 15:67176536-67176558 CCTCCCCACCTCTTCCTTTACGG + Intronic
1130353518 15:83110671-83110693 CACACCCACCTCTTCCCTCATGG + Intronic
1130547551 15:84868082-84868104 CCCACTCAGCTCTTCCTGTCTGG + Intronic
1130654692 15:85784231-85784253 CCCAGCCAACTCTGCTTTTAAGG - Intronic
1132578482 16:674695-674717 CCCTCCCATGTCTGCCTTTAGGG + Intronic
1133746234 16:8688741-8688763 CCAAGCCTGGTCTTCCTTTATGG + Intronic
1133757734 16:8775217-8775239 CCCTCCCAGCTCTCTCTGTAAGG + Intronic
1133846816 16:9462328-9462350 CCTAACCACCTCTTCTTTTAAGG + Intergenic
1135040978 16:19116037-19116059 CGCACCCAGGGCTTCCTTGAAGG + Exonic
1135164434 16:20126277-20126299 CCCACCCTCCTCTTCCTGTTTGG + Intergenic
1135524864 16:23206452-23206474 CCCAGCAAGCTCATTCTTTAAGG - Intronic
1137379799 16:47986707-47986729 CCCACCCAGATCTTCTTTTCAGG - Intergenic
1137500016 16:49003740-49003762 ACCTCCCAGTTCTTCCTTAACGG - Intergenic
1138555458 16:57768587-57768609 CCCACCCAACTCTTCCAATGTGG - Intronic
1140781279 16:78299000-78299022 GCAACCCAGCTCATCCTTTTTGG - Intronic
1143029421 17:3959630-3959652 CTCACCCAGGTCTTCCTCAAAGG + Intronic
1143372475 17:6448978-6449000 TAAACTCAGCTCTTCCTTTACGG - Intronic
1145824321 17:27865777-27865799 CCCACCCCTCTCCTCCCTTAGGG + Intronic
1146791392 17:35752731-35752753 CTCAGCCAGGTCTTCCTTCATGG + Exonic
1147703122 17:42408291-42408313 ACCAGCCAGCTCAGCCTTTAGGG - Intronic
1149458900 17:56811400-56811422 CCCACCCAGCTGTGGCTTGAAGG - Intronic
1149603129 17:57905839-57905861 CCCACACAACCCTTCCTTTTAGG - Intronic
1149867376 17:60158177-60158199 CACACCCACCCCTTCCTTTGTGG - Intronic
1150806017 17:68319708-68319730 CCTAGCCAGCTCTGCCCTTAAGG + Intronic
1152982881 18:295480-295502 ACCACCCACACCTTCCTTTAGGG - Intergenic
1154025137 18:10699683-10699705 CCCACCCATCTCTTCCCTACTGG - Intronic
1154083513 18:11280502-11280524 CCCACCCTGCTCTTCCATCACGG - Intergenic
1156550205 18:38007997-38008019 CAAACCCAGCTCCTCCATTAAGG + Intergenic
1156864442 18:41873227-41873249 CCCACCTAGCCCCTCTTTTAAGG + Intergenic
1157294987 18:46435822-46435844 CCCACCCAGCACTGCCTTGCTGG - Intronic
1160202417 18:76806697-76806719 CCCAGCCAGGTCATTCTTTACGG + Intronic
1161115790 19:2495701-2495723 CCCACCCTGCCCTCCCTCTACGG - Intergenic
1161126401 19:2560450-2560472 CCCACCCAGCCCTTCCCTTGAGG + Intronic
1161627587 19:5336251-5336273 CCCCCCCCCCTTTTCCTTTAAGG - Intronic
1161842877 19:6693440-6693462 ACAACCCAGCTCTGCCTTTGCGG - Exonic
1163094099 19:15043154-15043176 TCCACCCAGTTCTTCCTTCTTGG + Intergenic
1163102836 19:15108199-15108221 CCCACGCAGCTGTTTCTCTAAGG - Intronic
1164462939 19:28464173-28464195 CCCTTCCAGCTCTGCCTTTGAGG - Intergenic
1165664890 19:37619795-37619817 CCCAGCTAGCCTTTCCTTTATGG - Intronic
1165710077 19:38004750-38004772 CCCAGCCCGCCCTTCCTCTATGG - Intronic
1165774152 19:38395169-38395191 CCCAGCCACCTCCTCCTTAAAGG - Intronic
1165999915 19:39871771-39871793 CCCATCCAACTCTCCCTTTCAGG + Intronic
1166218534 19:41351740-41351762 CCCACCCAGCACTTCCCCTGCGG + Intronic
1166295568 19:41887758-41887780 CCCAGCCCCCTCTTCCATTAGGG + Intronic
1167139036 19:47636899-47636921 CACACCAACCTCTTCCTTCAAGG + Intronic
1168137928 19:54364230-54364252 CCCACCCAGCACTGCCCTTGGGG + Intronic
1168160002 19:54503778-54503800 CCCACCCAGCACTGCCTTTGGGG - Intronic
925719638 2:6814401-6814423 CCCACCCTGCTCTTCCTCTGTGG - Intergenic
926069981 2:9879615-9879637 ATCACACAGCTCTTGCTTTAGGG - Intronic
926528179 2:14008654-14008676 CCCACCCACTCCTTCCTTTTGGG + Intergenic
928027391 2:27751487-27751509 CCCACTGAGCTCTTCCTAAAAGG - Intergenic
932721633 2:74142961-74142983 CCCACCAAGCTCTGCCTCGAGGG - Intronic
933727234 2:85433838-85433860 CCCACCCAGCCCATGCTCTAAGG - Intronic
935146598 2:100399676-100399698 CCCACCCAGCTCTTCCTTTATGG + Intronic
936008591 2:108910597-108910619 CCAACCCTGCTCTTCCTGTTGGG + Intronic
937291875 2:120786818-120786840 CCAACCCAGCCCTCCCTTAAAGG + Intronic
937299733 2:120831966-120831988 CCCACCCATCGCTTCCCATATGG + Intronic
940537426 2:154963502-154963524 CACACACAGCCCTTCCTCTAAGG + Intergenic
942943174 2:181643825-181643847 CCCCATCAGCTTTTCCTTTACGG + Intronic
944311516 2:198238897-198238919 CCAACCCCTCTCTTCCTTGAGGG + Intronic
948081307 2:235207431-235207453 CACACCCAGCCCTGCCTTCATGG + Intergenic
1168777633 20:461853-461875 ACCACACAGTTCTTCCTTTAAGG - Intronic
1168907570 20:1418277-1418299 AGCACCCAGATTTTCCTTTAGGG + Intergenic
1169636780 20:7701065-7701087 CCCTCCAAGCTCTTCCTCTCTGG - Intergenic
1170708195 20:18765168-18765190 CTCCTTCAGCTCTTCCTTTACGG - Intergenic
1171043413 20:21788256-21788278 CCTTCCCAGCTCCTCCTTTCAGG + Intergenic
1171364777 20:24616408-24616430 TCCTCCCAGCTCTGCCTTTGGGG + Intronic
1172749242 20:37238301-37238323 CCCAACCAGAGCTTCCATTAGGG - Intronic
1175103369 20:56596045-56596067 CCCACCCAGCTTTTCCTGACTGG + Intergenic
1175350248 20:58312890-58312912 CATACCCAGCTCTTTCTTAAAGG - Intronic
1175880979 20:62258945-62258967 CCACCCCAGCACTGCCTTTATGG + Intronic
1176168500 20:63686671-63686693 CCCTCCCAGCCCTTCCCTTCCGG - Intronic
1176985500 21:15431329-15431351 CCCACCCAGATCCTCCTGTAGGG - Intergenic
1178314048 21:31554505-31554527 TACACCCAAGTCTTCCTTTAAGG + Intronic
1180062772 21:45394032-45394054 CGAACCCAGCTCTTCCCTTGTGG + Intergenic
1180763125 22:18223765-18223787 TCCACCCAGCTCTTCCACTTTGG + Intergenic
1180772520 22:18400782-18400804 TCCACCCAGCTCTTCCACTTTGG - Intergenic
1180803900 22:18650398-18650420 TCCACCCAGCTCTTCCACTTTGG - Intergenic
1180806863 22:18719051-18719073 TCCACCCAGCTCTTCCACTTTGG + Intergenic
1181217818 22:21344861-21344883 TCCACCCAGCTCTTCCACTTTGG + Intergenic
1181438546 22:22924098-22924120 CCCACCCAGCCCCTCCTGCATGG + Intergenic
1181646007 22:24232191-24232213 CCCAGCCAGCTCTTCTTCAACGG - Exonic
1182748328 22:32622615-32622637 CCCTCCCAGCTCTGACTTTCTGG - Intronic
1183437999 22:37806430-37806452 CCCACCCACATCTACCTTCATGG - Exonic
1184231351 22:43159926-43159948 CCCTCCCAGCACGTCCTTTCCGG - Intronic
1184644435 22:45888593-45888615 CCCACCAAGCACTTCCATTCTGG + Intergenic
1184834280 22:47011984-47012006 CCCACCCCGCTCTGCCTTGGTGG + Intronic
1184975883 22:48061613-48061635 CCCTCCCAGCTCTGGCTTTCTGG - Intergenic
1203234358 22_KI270731v1_random:141770-141792 TCCACCCAGCTCTTCCACTTTGG - Intergenic
949917425 3:8975627-8975649 CCCGCACAGCTCTTTCTCTAGGG + Intergenic
950137024 3:10588672-10588694 CCCACTCAGCACTTCCTCTGGGG + Intronic
950303428 3:11900919-11900941 CCCCCACAGCCCTTCCTTTCTGG + Intergenic
951030450 3:17875829-17875851 CCCAGCCAGCTCAGCCTTTAGGG - Intronic
951634906 3:24763183-24763205 CCCAACAACCTCTTCCTTCAAGG + Intergenic
953509409 3:43520190-43520212 CCTCCCCAGCTCTTACTTTTAGG + Intronic
953699248 3:45183347-45183369 TCCACCCAGCTCTGCCTGCAAGG - Intergenic
954347566 3:50013134-50013156 CCCACCAGACTCTTCCTTTGAGG + Intronic
954394969 3:50288604-50288626 CGAACCCAGCACTTCCTTGAAGG + Exonic
954766004 3:52917373-52917395 CCGACCCCTCTCTTCCTGTAAGG - Intronic
956008017 3:64801151-64801173 CACCCTCATCTCTTCCTTTATGG + Intergenic
956597835 3:70987741-70987763 AGCACCCAGCTCTTCTTTAAAGG - Intronic
958095290 3:88936230-88936252 GCCACACAGCTCCTCCTTTAGGG - Intergenic
958664231 3:97113608-97113630 GCCACCCAGTTCTCCCTTTGGGG - Intronic
963110734 3:141685867-141685889 CCCAGCGAGCTGTTCCTTGATGG + Intergenic
965474636 3:169140149-169140171 CCTACCCTGCTCTGCCTTTCAGG + Intronic
965916724 3:173857405-173857427 CCCTCCCAGGTCTACCTTTGAGG + Intronic
966303865 3:178509180-178509202 CCCACCCAGATCTCTCTTCATGG + Intronic
966336555 3:178874337-178874359 CCCTCCCAGTTCTTCCTTTCTGG - Intergenic
966470367 3:180282322-180282344 GCTACCCAGATCTTCCTTCAAGG + Intergenic
967234340 3:187369463-187369485 CCCTCCCTGCTCATCCTTCAAGG + Intronic
967338284 3:188368889-188368911 CACACACACCTCTTCCTTTCAGG - Intronic
967929416 3:194679962-194679984 CCCAAGCAGCTCTTCCTAGAGGG + Intergenic
968960481 4:3740750-3740772 CAAACCCAGCTCTTCCTCCACGG - Intergenic
971080884 4:23209385-23209407 CCTCCCCAGATTTTCCTTTAGGG + Intergenic
971234808 4:24831179-24831201 CTCCTCCAGCTCTTCTTTTAGGG - Intronic
972585452 4:40433354-40433376 ACCACCCATCCCTTCCTCTAGGG - Intronic
972842067 4:42943012-42943034 CACATCCAGCCCTTCCATTAAGG - Intronic
976666829 4:87603681-87603703 CTCACTCAGGTTTTCCTTTAAGG - Intergenic
978257404 4:106709188-106709210 TCCACCCAGTTCTCCCTTTCCGG - Intergenic
984747651 4:183238609-183238631 CTCACCCCGCTGTCCCTTTAGGG + Intronic
985630813 5:1013104-1013126 TCCACCCAGCTCTGCATTTGGGG + Intronic
985693503 5:1326678-1326700 TCCATCCAGCTCCTCCTCTACGG + Intronic
985693510 5:1326707-1326729 TCCATCCAGCTCCTCCTCTACGG + Intronic
985693719 5:1327983-1328005 TCCATCCAGCTCCTCCTCTACGG + Intronic
986181471 5:5396963-5396985 GCCTCCCAGCTGTTCCTATAGGG + Intergenic
990338281 5:54796366-54796388 CCCTCCCATCTCTTCCTTGAGGG + Intergenic
991570078 5:68044656-68044678 CCTAACCAACTCTTCATTTAAGG + Intergenic
991695501 5:69267061-69267083 CCAAAGCAGCTCTTTCTTTAGGG + Intronic
993137023 5:83982206-83982228 CCCTCCCAGCTTTTCTTATATGG + Intronic
998041494 5:138953513-138953535 CCCACCCTGTACTTCCTTTCTGG - Intronic
999149999 5:149420586-149420608 CACACCCAGCTCTTTCTGGAGGG - Intergenic
1001276774 5:170357014-170357036 CCCACCCAGCCTTTCCTTCTGGG - Intronic
1001885277 5:175284634-175284656 ACCACTCAGATCTTCCTTTCAGG + Intergenic
1003331145 6:5129721-5129743 GCCTACCAGATCTTCCTTTATGG + Intronic
1004010304 6:11679289-11679311 CCCAGCCATATCTTGCTTTAGGG - Intergenic
1004520299 6:16355455-16355477 CCCACCAAGCTCATCCATCAGGG - Intronic
1006336342 6:33422803-33422825 TCAACCCTGCTCATCCTTTAGGG - Intronic
1012344384 6:98168834-98168856 CCCAGCCACCCCTTCATTTAAGG - Intergenic
1013191872 6:107810454-107810476 TCCACCTATCTCTTCCTTTCTGG - Intronic
1014664654 6:124222068-124222090 CCTATCCAGATCATCCTTTACGG - Intronic
1015185291 6:130408836-130408858 GCCACTCAGATCTCCCTTTAGGG + Intronic
1016025047 6:139278414-139278436 CCCTCCCAGCTCTCCAATTATGG + Intronic
1016360823 6:143265888-143265910 CCTTCCCAGCTGTTCCTTCAAGG + Intronic
1016939049 6:149469665-149469687 CACACACAGCCCTACCTTTAAGG + Intronic
1020203937 7:6101235-6101257 CCCACCCAGGTCCTCCTTACTGG - Intergenic
1021176137 7:17451644-17451666 ACTACCCAGGTCTTCCTGTAGGG - Intergenic
1022090684 7:27106262-27106284 CCCACCCAGCTTTCTTTTTATGG - Exonic
1022466318 7:30655194-30655216 CCCACCCAGCTCTGACTCCAGGG - Intronic
1023299133 7:38750160-38750182 CCCAACCAGAACTTACTTTAAGG + Intronic
1023814116 7:43936322-43936344 CACACTCAGTTATTCCTTTACGG - Intronic
1023981981 7:45075709-45075731 CCCACTCAGCTCTTCTCTCAGGG - Intronic
1026976759 7:74503409-74503431 CCATCCCAGCTCTGCCTTTTGGG + Intronic
1028801382 7:94969906-94969928 CCCACCCAGTTCGACCTTTCTGG + Intronic
1032806309 7:135358229-135358251 ACCACCCAGATCTTCCAATAGGG + Intergenic
1032856121 7:135834945-135834967 CCCTCCCATCTCTTTCTTTCAGG + Intergenic
1035148521 7:156844983-156845005 ACCACCCAGCCTTTCATTTAAGG + Intronic
1036056771 8:5263508-5263530 CCCACACAGCTCATCCTGTTTGG + Intergenic
1037465775 8:19158765-19158787 CCGGCCCACTTCTTCCTTTAAGG - Intergenic
1038163806 8:25065417-25065439 CCCTCCCACTTATTCCTTTATGG + Intergenic
1038241274 8:25809767-25809789 CCCAGCCTGCTCTTCTTTTAGGG + Intergenic
1038462560 8:27729295-27729317 AGCACATAGCTCTTCCTTTAGGG - Intergenic
1041255762 8:55978627-55978649 CCCTCTCAGCCCTTTCTTTAGGG - Intronic
1042140920 8:65677673-65677695 CCCAGCCAGCTATTTCTTAATGG + Intronic
1042344945 8:67717823-67717845 CCCTCCTAGCTCTTCCTCCATGG - Intronic
1043324489 8:79033671-79033693 CCCACCCTGCTTTTCTTTTCTGG - Intergenic
1045500087 8:102738370-102738392 CCCAGCCACCTCTTCCTGGATGG - Intergenic
1047317223 8:123745763-123745785 CCCTCTCAACTCTTCCTTTGGGG - Intergenic
1047661235 8:127039243-127039265 CCCACCCACCTTTTCCATTACGG + Intergenic
1047846142 8:128807526-128807548 GCCACCCACATCTGCCTTTAGGG + Intergenic
1048880672 8:138869871-138869893 CCCACCCAGCTGTTCCCTCTGGG - Intronic
1049461988 8:142734559-142734581 CCAGCCCAGCTCTTCCTCTTTGG - Intronic
1051626327 9:19102897-19102919 CGCACACTGCTCTTCCTTAAGGG - Exonic
1052320817 9:27165460-27165482 CCCTGTCTGCTCTTCCTTTATGG + Intronic
1056488907 9:87085897-87085919 TCGGCCCAGCTCGTCCTTTATGG - Intergenic
1056709256 9:88977421-88977443 CCCAGCCAGCTCTGCCAGTACGG - Intergenic
1056829596 9:89904582-89904604 CCCACCCAGATTTTCTTTTTTGG + Intergenic
1060309425 9:122445958-122445980 CTCTCCCAGCTCTTCCCTCAGGG + Intergenic
1060788680 9:126470514-126470536 CCCCCCCACCTCCTCCTTCAGGG - Intronic
1061422944 9:130481994-130482016 CCCTCCCAGCTCTCCCTGGAGGG - Intronic
1062232186 9:135487757-135487779 TCCACCCAGCTCTTCCACTTTGG + Exonic
1186281199 X:7995049-7995071 GCCACCCAGATCATCCTTCAAGG + Intergenic
1186834984 X:13428764-13428786 GCCAGCAAGCTCTTCCTTTGGGG + Intergenic
1187247238 X:17563741-17563763 CACACACAGCCCTTCCTTTCTGG - Intronic
1188104976 X:26138793-26138815 CCCACCCCGCTCCTGCCTTATGG + Intronic
1190022851 X:46895085-46895107 CCCAGCCAGCACTTTCTTAAAGG + Intronic
1190066942 X:47247897-47247919 CCCACCCAGCTCTGAGTTCATGG + Exonic
1190949796 X:55132334-55132356 CCAAGGCAGCTCTTCCTATATGG - Intronic
1197523863 X:127536914-127536936 CCACCTCAGCTCTTCCTTTTTGG - Intergenic
1198190175 X:134296279-134296301 CCCACCCACCTTTTCCTACAAGG - Intergenic
1200375437 X:155774953-155774975 CCCTGCCAGCTCAGCCTTTATGG + Exonic