ID: 935147837

View in Genome Browser
Species Human (GRCh38)
Location 2:100408321-100408343
Sequence ATGGAGTGGCGGAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1481
Summary {0: 1, 1: 0, 2: 4, 3: 85, 4: 1391}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935147837_935147843 -7 Left 935147837 2:100408321-100408343 CCCTCCTCCTTCCGCCACTCCAT 0: 1
1: 0
2: 4
3: 85
4: 1391
Right 935147843 2:100408337-100408359 ACTCCATGTCAGAGATAGTGAGG 0: 1
1: 0
2: 1
3: 4
4: 148
935147837_935147845 14 Left 935147837 2:100408321-100408343 CCCTCCTCCTTCCGCCACTCCAT 0: 1
1: 0
2: 4
3: 85
4: 1391
Right 935147845 2:100408358-100408380 GGCACAAAGAACCCCAGACTTGG 0: 1
1: 0
2: 0
3: 31
4: 329

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935147837 Original CRISPR ATGGAGTGGCGGAAGGAGGA GGG (reversed) Intronic
900149084 1:1170500-1170522 ATGGAGGAGAGGAAGGAGGAGGG - Intergenic
900190995 1:1352154-1352176 GAGGAGTGGCGGGAGCAGGAAGG - Intergenic
900195778 1:1374888-1374910 TTGGGGTGGCGGAGGGAGAAGGG - Exonic
900249524 1:1660335-1660357 ATGGAGTGGAGGCGGGAGAATGG - Intronic
900260460 1:1725646-1725668 ATGGAGTGGAGGCGGGAGAATGG - Intronic
900260579 1:1726330-1726352 ATGGAGTGGAGGCGGGAGAATGG - Intronic
900295817 1:1948965-1948987 AAGGAGGGAGGGAAGGAGGAAGG - Intronic
900427624 1:2587645-2587667 ACAGAGGGTCGGAAGGAGGAGGG + Intronic
900567498 1:3340822-3340844 ATGGGGTGGCTGAAGGCAGAAGG + Intronic
900735781 1:4298634-4298656 ATGGAGTGGGTGAATGAGGAGGG + Intergenic
900868906 1:5287977-5287999 ACCGAGTAGCAGAAGGAGGAAGG - Intergenic
900993130 1:6106976-6106998 ATGGAGGGGTGGAAGGATGGAGG + Intronic
900993149 1:6107055-6107077 ATGGAGCGATGGAAGGATGATGG + Intronic
900993163 1:6107098-6107120 ATGGAGGGGTGGAAGGACGGAGG + Intronic
900993468 1:6108307-6108329 ATGGAGAGACGGAGGGATGAAGG + Intronic
900993533 1:6108583-6108605 ATGGAGGGGTGGAAGGATGGAGG + Intronic
900993558 1:6108680-6108702 ATGGAGGGGTGGAAGGATGGAGG + Intronic
900993604 1:6108855-6108877 ATGGAGGGGTGGAAGGACGGAGG + Intronic
900993615 1:6108890-6108912 ATGGAGGGGTGGAAGGATGGAGG + Intronic
901004006 1:6162952-6162974 AGGGAGAGCCGGAAGGAGGGAGG + Intronic
901168847 1:7239828-7239850 ATCGCGTGGTGGAAGGTGGAAGG + Intronic
901282414 1:8049263-8049285 ATGGGGTGGGGGAAGGGGGGAGG - Intergenic
901447736 1:9318472-9318494 TGGGAGTGGAGGAAGGAGGGTGG - Intronic
901452483 1:9344565-9344587 GTTGAGAGGCGGCAGGAGGAGGG + Intronic
901642787 1:10701516-10701538 ATGGAGTGATGGGAGGAGGGGGG + Intronic
901787181 1:11632436-11632458 AGGGAGTGTGGGAAGGAGGGAGG + Intergenic
902190290 1:14758150-14758172 ATGGAGGGAGGGAGGGAGGAAGG - Intronic
902517633 1:16997875-16997897 AAGGGGAGGGGGAAGGAGGAGGG + Intronic
902634147 1:17724201-17724223 ATGTAGGGGTGGAAGGAGGCTGG - Intergenic
902712525 1:18250058-18250080 ATGGAAGGGGGGAGGGAGGAGGG - Intronic
903107350 1:21093953-21093975 ATGGGGTGGGGGAAGGAGGGAGG + Intronic
903331651 1:22599878-22599900 AGGGAGTGGGGGAGGAAGGAAGG + Intronic
903331671 1:22599930-22599952 AGGGAGTGGGGGAGGGAGGGAGG + Intronic
903331703 1:22600039-22600061 AGGGAGTGGAGGAGGAAGGAAGG + Intronic
903331732 1:22600124-22600146 AAGGAGAGAAGGAAGGAGGAGGG + Intronic
903387615 1:22938221-22938243 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
903406781 1:23103916-23103938 AGGGAGGGGGGGAAGGAGGGAGG + Intronic
903964317 1:27076995-27077017 AAGGAGGGAAGGAAGGAGGAAGG - Intergenic
904040473 1:27581557-27581579 TTGGACTGGAGGAAGGAGTAGGG - Intronic
904087158 1:27917029-27917051 AAGGAGGGAGGGAAGGAGGAAGG - Intergenic
904480702 1:30791581-30791603 AGGGAGAGAAGGAAGGAGGAAGG + Intergenic
904909454 1:33922876-33922898 ATGGATGGGCTGGAGGAGGAAGG - Intronic
905309116 1:37037384-37037406 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
905322854 1:37130171-37130193 CTGGGGTGGGGGAAGGGGGATGG - Intergenic
905414498 1:37794776-37794798 CTGGGGTGTGGGAAGGAGGAAGG - Intronic
905472310 1:38202673-38202695 ATTGGGTGGAGGAAGGAGCAGGG + Intergenic
905964276 1:42077996-42078018 ATGGGGTGGCGGGAGGGGGGAGG + Intergenic
906013955 1:42556223-42556245 AGAGAGGGGCAGAAGGAGGAGGG + Exonic
906185216 1:43857522-43857544 AGGGAGGGAGGGAAGGAGGAGGG - Intronic
906546263 1:46621316-46621338 GTGCTGTGGAGGAAGGAGGAGGG - Intergenic
906783988 1:48597891-48597913 AGGGAGGGAGGGAAGGAGGAAGG + Intronic
906794804 1:48688352-48688374 ATGGAGATGAGGAAGCAGGAAGG - Intronic
907243879 1:53094913-53094935 ATGGGGTGGGGAAAGGAGGCTGG + Intronic
907334568 1:53691797-53691819 TTGGAGTGGGGGTAGGAGGGAGG - Intronic
907437428 1:54458761-54458783 AGGGAGGGAAGGAAGGAGGAAGG + Intergenic
907951622 1:59189030-59189052 TAGGAGTGGGGGATGGAGGAGGG + Intergenic
908017518 1:59858906-59858928 AGGGAGGGGGGGAAGGAGGGAGG + Intronic
909005051 1:70265888-70265910 ATGGAGGGAGGGAAAGAGGACGG + Intronic
909087606 1:71186349-71186371 ATGGGGTGGGGGGAGGGGGAAGG - Intergenic
909296387 1:73954381-73954403 AAGGAAGGGAGGAAGGAGGAAGG - Intergenic
909663608 1:78110036-78110058 GTGGGGTGGGGGAAGGGGGAGGG + Intronic
909770917 1:79420138-79420160 GTGGGGTGCCGGAAGGGGGAAGG + Intergenic
909907395 1:81215394-81215416 ATGGGGTGGGGGAAGGGGGGAGG - Intergenic
910131823 1:83916490-83916512 GTGGAGTGGGGGAGGGGGGAGGG + Intronic
910211693 1:84800251-84800273 ATGGAGCAGAGGAAGGGGGAAGG + Intergenic
910275189 1:85442170-85442192 GTGGGGTGGCGGGAGGAGGGAGG - Intronic
910942360 1:92550346-92550368 ATGGGGTGGGGGGAGGGGGAGGG + Intronic
911346819 1:96706742-96706764 CTGGAGTGGAGGAGTGAGGAGGG + Intergenic
911535534 1:99095382-99095404 ATGGAGTGCCCAAAGGTGGAGGG - Intergenic
911629816 1:100170680-100170702 ATGGAGGGAGGGAAGGAGGAAGG - Intronic
911849859 1:102804528-102804550 GTGGAGTGGGGGAAGGGGGGAGG - Intergenic
912065193 1:105730017-105730039 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
912308480 1:108595435-108595457 AGGGAGGGAGGGAAGGAGGAAGG + Intronic
912594511 1:110860636-110860658 ATGGGGTGGGGGGAGGGGGAGGG - Intergenic
912613499 1:111073667-111073689 ATGGGGTGGGGGAATGGGGAGGG - Intergenic
912663872 1:111561501-111561523 ATGTATTGGGGGAAGGAGGGAGG + Intronic
913522206 1:119655329-119655351 AGGAAGTGGAGGGAGGAGGAGGG + Intergenic
913601078 1:120421527-120421549 AGGGAGGGAAGGAAGGAGGAAGG - Intergenic
913930744 1:124961979-124962001 ATGGGGTGGGGGGAGGGGGAAGG - Intergenic
914085967 1:144455074-144455096 AGGGAGGGAAGGAAGGAGGAAGG + Intronic
914191864 1:145419054-145419076 AGGGAGGGAAGGAAGGAGGAAGG + Intergenic
914589789 1:149097055-149097077 AGGGAGGGAAGGAAGGAGGAAGG + Intronic
914677887 1:149917852-149917874 CTGGAGTGGTGGAAGGGGGGTGG - Exonic
914923727 1:151865375-151865397 AGGGAGTTGCAGCAGGAGGAAGG - Intergenic
914925986 1:151888125-151888147 AGGGAGTGGGAGAAGCAGGACGG - Intronic
915035263 1:152918401-152918423 AGGGAGGGAGGGAAGGAGGAAGG + Intergenic
915631874 1:157159105-157159127 AAGAAGTGGTGGAAGCAGGAAGG - Intergenic
915707495 1:157860617-157860639 ATGGGGTGGGGGAGGGGGGAGGG - Intronic
916060454 1:161094901-161094923 ATGGAGAGGTGGAATAAGGATGG - Intergenic
916138943 1:161676800-161676822 AGGGAGGGACGGAAGGAGAAAGG - Intronic
916332076 1:163628341-163628363 ATGGAGGGGGAGGAGGAGGAGGG - Intergenic
916352118 1:163862468-163862490 ATGCAGTGGCAGAGGGAGAAGGG + Intergenic
916452096 1:164930527-164930549 AAGGAGGGAGGGAAGGAGGAAGG - Intergenic
916651118 1:166835646-166835668 AGGGAGGGGAGGAAGGAGGGAGG - Intergenic
916976578 1:170086743-170086765 AGGGAGGGGGGGAGGGAGGAAGG - Intergenic
917485480 1:175451362-175451384 GTGGGGTGGGGGAAGGGGGAAGG - Intronic
917628165 1:176866519-176866541 AGGGAGTGGCAGAAGAGGGAGGG + Intronic
917803532 1:178592950-178592972 ATGGGGTGGGGGGAGGGGGAGGG + Intergenic
918543562 1:185657662-185657684 AGGGAGTGAGGGAGGGAGGAAGG - Intergenic
918606827 1:186437601-186437623 GTGGGGTGGCGGGAGGGGGAAGG - Intergenic
918617094 1:186557484-186557506 AGAGAGTGGAGGGAGGAGGAGGG - Intergenic
918625515 1:186652416-186652438 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
918761834 1:188420492-188420514 AGGGAGTGAGGGAGGGAGGAAGG - Intergenic
918761847 1:188420536-188420558 AGGGAGAGACAGAAGGAGGAAGG - Intergenic
919281411 1:195494798-195494820 GTGGAGTGGGGGAAGGGGGAGGG - Intergenic
919357874 1:196549004-196549026 GTGGGGTGGGGGAGGGAGGAGGG + Intronic
920044946 1:203127111-203127133 ATGAAGAGGAAGAAGGAGGAAGG + Exonic
920127397 1:203704250-203704272 AAGGACTGGAGGAAGAAGGAAGG + Intronic
920697199 1:208189996-208190018 TTGGGGTGGGGGAAGGAGGGTGG + Intronic
920924804 1:210330766-210330788 ATGGACTGGGGGAAGGGGGATGG + Intronic
921267848 1:213440175-213440197 AGGGAGTTGGGGAAGGATGATGG - Intergenic
921269890 1:213458146-213458168 TTGTAGAGGGGGAAGGAGGATGG - Intergenic
921353035 1:214256939-214256961 ATGGAGTGGAGGACTGAGAAGGG + Intergenic
922030955 1:221797667-221797689 ATGGAGTGGGAGAAAGAGGAAGG + Intergenic
922741646 1:228017375-228017397 GTGGAGAGGCCGCAGGAGGAGGG + Intronic
922755349 1:228093554-228093576 ATGGAATGGCAGAACCAGGATGG - Intronic
923474988 1:234323728-234323750 ATGGAGGGATGGAAGGAGGGAGG + Exonic
923915763 1:238502649-238502671 GTGGAGTGGGGGAGGGGGGAGGG + Intergenic
924039668 1:239971929-239971951 AAGGAGGGAGGGAAGGAGGAAGG + Intergenic
924091604 1:240507308-240507330 AGGGAGGGAGGGAAGGAGGAAGG - Intronic
924129818 1:240895429-240895451 ATGGGGTGGAGGAGGGGGGAGGG - Intronic
924247228 1:242096885-242096907 AGGGGGAGGGGGAAGGAGGAGGG - Intronic
924728656 1:246692607-246692629 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
924880506 1:248157026-248157048 ATGGGGTGGAGGGAGGGGGAAGG - Intergenic
924888618 1:248248473-248248495 AGGGAGTGACAGAGGGAGGAAGG + Intergenic
1062773400 10:123639-123661 ATGGAGGGAAGGAAGGAGGAAGG + Intergenic
1062805310 10:415383-415405 AAGGAGAGGCAGCAGGAGGAGGG + Intronic
1062812490 10:477341-477363 AGGGAGGGGAGGAAGGTGGATGG + Intronic
1063206412 10:3835662-3835684 ATGTACTGGAGGAAGGAGCAGGG - Intergenic
1063953947 10:11248417-11248439 ATGGAGAGGAGGAGGGTGGAAGG - Intronic
1063999849 10:11654298-11654320 AGGGAGGGAGGGAAGGAGGAAGG + Intergenic
1064002227 10:11673262-11673284 AGGGAGGGAAGGAAGGAGGAAGG - Intergenic
1064245457 10:13664353-13664375 ATGGAGTGTCAGAAAGAGGTTGG + Intronic
1064526387 10:16260641-16260663 ATGGAGGGAGGGAAGGAGGGAGG + Intergenic
1064566829 10:16648203-16648225 AGGAAGTGGAGGCAGGAGGATGG - Intronic
1064600980 10:16992240-16992262 ATGGGGTGGGGGAAGGGGGGAGG + Intronic
1064652100 10:17519652-17519674 AAGGAGGGAGGGAAGGAGGAAGG + Intergenic
1064841446 10:19596829-19596851 AGGAAGTGGGGGAAGGAGGGAGG + Intronic
1064911426 10:20405697-20405719 ACGGAGAGGGGGAAGGAGTAGGG + Intergenic
1065383954 10:25115433-25115455 ATGGAGGGAAGGAAGGAGGGAGG - Intergenic
1065709034 10:28497721-28497743 AAGGAGGGAAGGAAGGAGGAAGG + Intergenic
1065795941 10:29308408-29308430 ATGGGGTGGAGGAAGCAGGATGG - Intronic
1066483205 10:35817469-35817491 ATGGAGTGGGGGGAGGGGGGAGG + Intergenic
1066594173 10:37030601-37030623 GTGGGGTGGGGGAAGGGGGAAGG + Intergenic
1066625529 10:37401986-37402008 AGGGAGGGAAGGAAGGAGGAAGG - Intergenic
1067300967 10:45009315-45009337 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
1067346457 10:45441979-45442001 ATGGGCTGGGGAAAGGAGGAAGG - Intronic
1067398847 10:45951810-45951832 ATGGGGTGGAGAAAGAAGGACGG + Intergenic
1067458612 10:46441114-46441136 GGGGAGTGGGGGAAGGAGGGAGG - Intergenic
1067628584 10:47943522-47943544 GGGGAGTGGGGGAAGGAGGGAGG + Intergenic
1067790715 10:49285488-49285510 AGGGCCTGGGGGAAGGAGGATGG + Intergenic
1067867168 10:49921046-49921068 ATGGGGTGGAGAAAGAAGGACGG + Intronic
1068366715 10:56060498-56060520 ATGGGGTGGGGGAAGGGGGGAGG - Intergenic
1068803870 10:61172757-61172779 AAGGAGGGACGGAGGGAGGATGG + Intergenic
1069159621 10:65078251-65078273 GTGGGGTGGGGGGAGGAGGAAGG - Intergenic
1069815000 10:71188175-71188197 ATGGAGTGGGGGGAGTGGGAGGG + Intergenic
1070030671 10:72674173-72674195 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
1070263028 10:74876201-74876223 GGGGAGTGGGGGAAGAAGGAGGG - Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070636209 10:78130099-78130121 GTGGGGTGGGGGTAGGAGGAAGG + Intergenic
1070768273 10:79068604-79068626 AGGGAGTAGCGGAGGGAGTAGGG + Intergenic
1071304538 10:84286830-84286852 ATGGAGTAGGGGTGGGAGGAAGG + Intergenic
1071371070 10:84952400-84952422 ATGGGGTGGTGGAGAGAGGAGGG + Intergenic
1072196653 10:93121890-93121912 AAGGAGTGAGGGAAGGTGGACGG - Intergenic
1072379750 10:94855950-94855972 ATGGGGTGGGGGATGGGGGAGGG - Intergenic
1072394472 10:95024682-95024704 GTGGAGTGGGGGGAGGGGGAAGG + Intergenic
1073048671 10:100654421-100654443 AGGGAGAGGAGGAAGGAGGGAGG - Intergenic
1073447222 10:103588970-103588992 AGTGAGTGACGGAAGGAGGAAGG + Intronic
1073588857 10:104736922-104736944 GTGGGGTGGGGGAAGGGGGAGGG - Intronic
1073671178 10:105591808-105591830 AGGGTGAGGAGGAAGGAGGAGGG + Intergenic
1073927248 10:108531303-108531325 ATGGGGTGGGGGAAAGGGGAGGG + Intergenic
1074119296 10:110481529-110481551 GTGGGGTGGGGGATGGAGGAGGG - Intergenic
1074145935 10:110717344-110717366 CTGGAGAGGAGGGAGGAGGAGGG - Intronic
1074300648 10:112230593-112230615 AAGGAGGGAAGGAAGGAGGAAGG + Intergenic
1074363363 10:112839702-112839724 CTGGAGTGGAGGTAGGAGTAGGG - Intergenic
1074410665 10:113225739-113225761 GTGGAGTGGAGGAAGGAAGAGGG + Intergenic
1074444876 10:113513435-113513457 AGGAAGTGGGGGAGGGAGGATGG - Intergenic
1074544619 10:114393072-114393094 AAGGAGAGGAGGAAGCAGGAAGG + Intronic
1074609140 10:115004461-115004483 ATGGAAGGGAGGAAGGAGGGAGG - Intergenic
1074624937 10:115172521-115172543 AGAGAGTGGCTCAAGGAGGATGG - Intronic
1074652513 10:115539979-115540001 ATGGGGTGGGGGGAGGGGGAGGG + Intronic
1074717918 10:116236680-116236702 ATGGAGTTGAAGAAGGAGAATGG + Intronic
1074722514 10:116274490-116274512 AAGAAGAGGAGGAAGGAGGAGGG + Intergenic
1074998842 10:118780182-118780204 AAGGAATGGAGGGAGGAGGAAGG - Intergenic
1075149098 10:119910643-119910665 ATGGAGAGGAGAAATGAGGAAGG - Intronic
1075203001 10:120421919-120421941 AGGGAGTGGAGGAAGGGGCATGG + Intergenic
1075244716 10:120810847-120810869 ATAGAGTGGGGGAAAGAGCAGGG - Intergenic
1075474024 10:122717777-122717799 TTGAAGTGAAGGAAGGAGGAAGG + Intergenic
1075498908 10:122954156-122954178 ATGGAGACGCGGACCGAGGACGG - Exonic
1075686333 10:124367614-124367636 TTGGAGGGGGGGAAGGAGGTGGG - Intergenic
1075686354 10:124367668-124367690 TTGGAGCGGGGGAAGGAGGTGGG - Intergenic
1076221947 10:128740889-128740911 GTGGGGTGGCAGAAGGAGGCTGG + Intergenic
1076523320 10:131094669-131094691 AGGGAGAGAAGGAAGGAGGAAGG - Intronic
1077070304 11:667354-667376 ATGGAGGGAGGGAGGGAGGAAGG + Intronic
1077268591 11:1664680-1664702 ATGGAGGGAGGGAAGAAGGAAGG + Intergenic
1077277501 11:1721059-1721081 AGGGAGTGGCGGGAGGCGCAGGG + Intergenic
1077643710 11:3904693-3904715 ATTGTGTGACGGAAGGATGAAGG + Intronic
1077841158 11:5976156-5976178 AGGGAGAGAAGGAAGGAGGATGG + Intergenic
1077923138 11:6655952-6655974 GTGGAGGGGCGGAGGGAGGCCGG - Intergenic
1078108197 11:8371838-8371860 AGGGAGGGAAGGAAGGAGGAAGG - Intergenic
1078307447 11:10204551-10204573 ATGGCGTGGAGGCAGGAGAATGG + Intronic
1078579465 11:12527263-12527285 ATAGAGGGAGGGAAGGAGGATGG + Intronic
1078728117 11:13950597-13950619 ATGGGGTGGGGGGAGGGGGAGGG - Intergenic
1079161535 11:17999496-17999518 GTGGAGTGGAGGAAGGAGAGAGG - Intronic
1079174491 11:18126633-18126655 GTGGGGTGGGGGAAGGGGGAGGG - Intronic
1079376541 11:19897232-19897254 GTGGGGTGGGGGGAGGAGGAGGG + Intronic
1079398256 11:20084560-20084582 ATTGAATGGGGGAAGGAAGAAGG + Intronic
1079408033 11:20162488-20162510 AGGGAGTGGGAGAAGGAGGGAGG - Intergenic
1079777526 11:24551430-24551452 CTTGAGTGGGGGAAGGAGAATGG + Intronic
1079960576 11:26918352-26918374 ATGGAGGGAGGGAAGGAGGGAGG + Intergenic
1080168332 11:29267665-29267687 GTGGGGTGGCGGGAGGGGGAGGG + Intergenic
1080744505 11:35096624-35096646 ATGGGGTGGGGGCAGGGGGAGGG + Intergenic
1080877559 11:36290435-36290457 ATGGAGTCGGGGAAGGGGAAGGG - Intergenic
1080888368 11:36387267-36387289 GTGGAGTGTGGGGAGGAGGAAGG + Intronic
1081164976 11:39797612-39797634 ATGGGGTGGGGGAAGGGGGGAGG - Intergenic
1081626491 11:44659063-44659085 ATGGAGAGATGGAAGGATGAAGG + Intergenic
1081746153 11:45473809-45473831 ATGGAGTGGAGGAAAGGGGCAGG + Intergenic
1081833930 11:46137921-46137943 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
1081906346 11:46672758-46672780 GTGGAGTCGCAGAAAGAGGAAGG + Intronic
1082173945 11:49040343-49040365 ATGGGGTGGGGGGAGGGGGAGGG - Intergenic
1082281475 11:50275433-50275455 AGGGAGTGAGGGAGGGAGGAAGG + Intergenic
1082300581 11:50499761-50499783 ATGGAGTGGGGCAGGGGGGAGGG + Intergenic
1082622421 11:55440381-55440403 GTGGGGTGGTGGGAGGAGGAGGG - Intergenic
1082743676 11:56939201-56939223 ATGGAGTGGGAGAAGTAGGGAGG - Intergenic
1082788394 11:57330347-57330369 TTGGAGAGGATGAAGGAGGAAGG - Exonic
1082873824 11:57968644-57968666 AGGGAGTGAGGGAAGAAGGAAGG - Intergenic
1082892401 11:58154095-58154117 AAGGGGAGGAGGAAGGAGGAGGG + Intronic
1082913912 11:58410243-58410265 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
1083301663 11:61742783-61742805 AGGGAGGGAGGGAAGGAGGAAGG - Intronic
1083478448 11:62928480-62928502 AAGGAATGAAGGAAGGAGGAAGG + Intergenic
1083829531 11:65222555-65222577 ATGAACGGGAGGAAGGAGGAAGG + Intergenic
1084194770 11:67518219-67518241 ATGGAGTTAGGGAGGGAGGAAGG + Intergenic
1084445051 11:69198766-69198788 ATGGAGAGATGGAAGGATGAAGG - Intergenic
1084501625 11:69538781-69538803 AGGGAGGGACGGAGGGAGGAAGG + Intergenic
1085569526 11:77547282-77547304 AAGGAGGGAGGGAAGGAGGAAGG - Intronic
1086455487 11:86955556-86955578 AGGGAGGGGCGGCCGGAGGAGGG - Intergenic
1086571638 11:88291520-88291542 AGGGAGGGAGGGAAGGAGGAAGG + Intergenic
1086593179 11:88540412-88540434 ATGGGGTGGAGGAAGGAGATTGG + Intronic
1086691820 11:89795736-89795758 ATGGGGTGGGGGGAGGGGGAGGG + Intergenic
1086713982 11:90043918-90043940 ATGGGGTGGGGGGAGGGGGAGGG - Intergenic
1088480377 11:110291356-110291378 AGGGAGGGACGGAGGGAGGAAGG + Intronic
1088710634 11:112505442-112505464 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
1088718915 11:112574791-112574813 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
1088904977 11:114148384-114148406 AGGGAGGGAGGGAAGGAGGAAGG - Intronic
1088908199 11:114170560-114170582 CTGGTTTGGGGGAAGGAGGAGGG - Intronic
1088912351 11:114201228-114201250 AGGGAGTGGAGGTGGGAGGAGGG + Intronic
1089016067 11:115166460-115166482 ATGGGGCTGGGGAAGGAGGAGGG + Intergenic
1089020151 11:115205462-115205484 CTGGGGTGGCGGGAGGAGGTGGG - Intronic
1089137453 11:116261110-116261132 ATGGGGTGGGGAGAGGAGGAGGG - Intergenic
1089161250 11:116439180-116439202 AGGGAGGGTAGGAAGGAGGAAGG + Intergenic
1089304549 11:117518212-117518234 CTGGACAGGAGGAAGGAGGAGGG + Intronic
1089333167 11:117704134-117704156 AGGGAGGGAGGGAAGGAGGAAGG + Intronic
1089386630 11:118072593-118072615 AGGGAGGAGAGGAAGGAGGAAGG + Intergenic
1089391476 11:118104853-118104875 AGGAAGAGGAGGAAGGAGGAAGG - Intronic
1089531484 11:119132705-119132727 ATGTGGTTGCGGAGGGAGGAAGG - Exonic
1089612535 11:119677485-119677507 AAGGAGAGGAGGAGGGAGGAGGG + Intronic
1089629101 11:119772733-119772755 ATGGGGTGGCAGCAGGAGGAGGG + Intergenic
1089958759 11:122597249-122597271 ATGGAGGGAGGGATGGAGGAAGG + Intergenic
1090028713 11:123189155-123189177 ATGGAGTGGGGGAAGGGGATGGG + Intronic
1090071814 11:123550560-123550582 GTGGGGTGGAGGAAGGTGGAGGG + Intronic
1090246068 11:125216736-125216758 GTGGAGGGGAGGAGGGAGGAGGG - Intronic
1090276192 11:125421444-125421466 ATGGTGTAGCGCAAGGAGCAAGG + Intronic
1090359354 11:126161778-126161800 ATGGGGTGGGGGGAGGGGGAGGG - Intergenic
1090906176 11:131076425-131076447 ATGGATTGGGGGAAGGCGAATGG - Intergenic
1091447481 12:552344-552366 CTAGAGTGGAGGAAGGAGGCTGG - Intronic
1091715171 12:2771758-2771780 ATGGAGGGGAGGGAGGAAGAAGG + Intergenic
1091860495 12:3777202-3777224 ATGGAGGGAGGGAAGGAGGGAGG + Intergenic
1092092234 12:5812499-5812521 AGGGAGGGAGGGAAGGAGGAAGG + Intronic
1093220993 12:16420545-16420567 ATGGAGTGAAGGGAGGAGAAAGG + Intronic
1093734592 12:22606239-22606261 AAGGAGAGAAGGAAGGAGGAAGG - Intergenic
1094020100 12:25904834-25904856 AAGGAGTGGAGGAATCAGGAAGG - Intergenic
1094770499 12:33652790-33652812 ATGGGGTGGGGGAAGGGGGGAGG - Intergenic
1095250091 12:39968940-39968962 GTGGGGTGGGGGAAGGAGGGAGG - Intronic
1096111323 12:49030933-49030955 AAGAAGCTGCGGAAGGAGGACGG - Exonic
1096156577 12:49344823-49344845 CTGGAGTAGGAGAAGGAGGAGGG + Intergenic
1096294602 12:50372965-50372987 AGGGAGGGACGGAGGGAGGAAGG + Intronic
1096439072 12:51623756-51623778 GTGGGGTGGGGGGAGGAGGAAGG - Intronic
1096595017 12:52689490-52689512 AGGGAGTAGGGGGAGGAGGAGGG + Intergenic
1096777411 12:53972803-53972825 CAGGATTGGGGGAAGGAGGAGGG - Intergenic
1097046224 12:56189439-56189461 ATGGCGGTGCGGAAGAAGGACGG - Exonic
1097473982 12:60031433-60031455 ATGAAGTGGTGGAATGAGCAAGG + Intergenic
1098336818 12:69412927-69412949 ATGCAGCGGTGGAAGGGGGAGGG + Intergenic
1098462521 12:70747995-70748017 AGGGTGTGGGGGAAGGAGAAGGG + Intronic
1098751796 12:74302167-74302189 ATGGAGTGGTGGAAAGAGAGTGG - Intergenic
1099173503 12:79393878-79393900 ATGGAGTGGGGAAAAGAAGAGGG - Intronic
1099196854 12:79626731-79626753 GTGGGGTGGGGGAAGGGGGAGGG - Intronic
1099239563 12:80123175-80123197 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
1099842495 12:87983532-87983554 GTGGGGTGGGGGAAGGGGGAGGG - Intronic
1099884051 12:88504969-88504991 ATGGGGTGGGGGGAGGGGGAAGG + Intronic
1100109287 12:91218563-91218585 TTGGGGTGGGGGAAGGGGGAAGG - Intergenic
1100209006 12:92381891-92381913 ATGGAGGGAGGGAGGGAGGAAGG + Intergenic
1100463993 12:94828858-94828880 ATGGGGTGGCGGGAGGAGGGAGG + Intergenic
1100565723 12:95791238-95791260 AGGGGGTGGCTGGAGGAGGAGGG - Intergenic
1101743310 12:107518602-107518624 ATGGGGTGGGGGGAGGGGGAAGG + Intronic
1101925623 12:108969236-108969258 AAGGAGGGAGGGAAGGAGGAGGG - Intronic
1101952416 12:109187066-109187088 ATGGAGGGAGGGAGGGAGGAAGG + Intronic
1101952440 12:109187143-109187165 AAGGAGGGAGGGAAGGAGGAAGG + Intronic
1101954339 12:109199925-109199947 ATGGCGTGAAGGCAGGAGGATGG + Intronic
1102249508 12:111376609-111376631 AGGGAGGGACGGAGGGAGGAAGG + Intergenic
1102432413 12:112893948-112893970 AAGGAGTGGGGTGAGGAGGATGG + Intronic
1102451505 12:113045079-113045101 GGGGAGTGGGGGAAGGAGGGAGG + Intergenic
1102536757 12:113587685-113587707 AAGGAGTGGGGGAAGTGGGAAGG - Intergenic
1102652488 12:114451971-114451993 AGGGAGAGGCGGAGGAAGGAAGG - Intergenic
1102785312 12:115599717-115599739 AGGGCGGGGCGGAGGGAGGAAGG + Intergenic
1103004350 12:117409356-117409378 ATGGAGGGGTGGAAGGTGGATGG + Intronic
1103030245 12:117606760-117606782 ATGAAGGGAGGGAAGGAGGAAGG - Intronic
1103528081 12:121580573-121580595 AGGGAGGGAGGGAAGGAGGAGGG + Intronic
1103949565 12:124543510-124543532 ATGGAGTGGCCGAGGGCAGAGGG - Intronic
1104172512 12:126295865-126295887 AGGGAGGGAAGGAAGGAGGAAGG + Intergenic
1104463316 12:128971715-128971737 ATGGAGGGGGGAAGGGAGGAGGG - Intronic
1104738650 12:131156238-131156260 AGGGAGGGAAGGAAGGAGGAAGG - Intergenic
1105239204 13:18595478-18595500 ATGGAGTGGCGGCTGCAGGGAGG + Intergenic
1105459049 13:20566973-20566995 AGGGAGTGGCGGTGGGCGGAGGG - Intergenic
1105508065 13:21028071-21028093 GTGGGGTGGGGGAAGGGGGAGGG - Intronic
1105945226 13:25183905-25183927 AAGAAGTTGTGGAAGGAGGAGGG - Intergenic
1106004620 13:25757116-25757138 ATGGAGTGGTGGGAGGAGGGAGG + Intronic
1106124609 13:26890137-26890159 CTGGGGTGGGGGGAGGAGGAGGG - Intergenic
1106288064 13:28335404-28335426 AGGGAGTGGAGTAATGAGGAAGG - Intronic
1106466502 13:30018819-30018841 GAGGAGTGGAGGAAGGATGAGGG - Intergenic
1106900607 13:34351396-34351418 ATGGATTAGCGGAGGGATGATGG + Intergenic
1107021220 13:35753966-35753988 AGGGAGAGAGGGAAGGAGGAAGG - Intergenic
1107153558 13:37140462-37140484 GTGGGGTGGGGGAAGGAGGGAGG - Intergenic
1107333087 13:39322696-39322718 AGGGAGAGAAGGAAGGAGGAAGG + Intergenic
1107382750 13:39875195-39875217 AAGGAGTGGGGCAAGGGGGAAGG + Intergenic
1107382980 13:39876989-39877011 ATGGAGGGAGGGAAGGAGGGAGG + Intergenic
1107402670 13:40084661-40084683 TTGGAGTGGCTGAATCAGGATGG - Intergenic
1107890415 13:44909676-44909698 ACGGAGTGGTGGAGGAAGGAGGG - Intergenic
1107917642 13:45168903-45168925 AGGGAGGGAAGGAAGGAGGAGGG - Intronic
1107958985 13:45542621-45542643 TTTGAATGGCGGAGGGAGGAGGG - Intronic
1107999999 13:45897202-45897224 AGGGAGGGAGGGAAGGAGGAGGG - Intergenic
1108088428 13:46819602-46819624 CTGGAGTGAAGGAAGGAGTATGG + Intergenic
1108156596 13:47591545-47591567 ATGGGGTGGGGGAAGGGGGCAGG + Intergenic
1108171041 13:47742185-47742207 CTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1108192750 13:47959409-47959431 AGGGAGAGGGAGAAGGAGGAGGG + Intronic
1108265432 13:48702259-48702281 ATGGGGTGGGGGGAGGGGGAGGG + Intronic
1108457206 13:50628520-50628542 ATGGGGTGGGGGAGGGGGGAGGG - Intronic
1108579284 13:51815037-51815059 ATGGACTGGGGAAAGGAGGGTGG + Intergenic
1108700262 13:52937741-52937763 ATAGAGTTGGGGGAGGAGGATGG + Intergenic
1108777503 13:53784348-53784370 ATCGAGTGGAGGGAGCAGGATGG + Intergenic
1108794799 13:54017893-54017915 ATGGAGGGAGGGAGGGAGGAAGG + Intergenic
1108794828 13:54018019-54018041 AGGGAGGGACGGAGGGAGGAAGG + Intergenic
1109058908 13:57587167-57587189 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1109061995 13:57632054-57632076 ATCGAGTGGGGGAGGGAGCAGGG - Exonic
1109365802 13:61354992-61355014 GTGGGGTGGGGGAAGGGGGAAGG - Intergenic
1109377922 13:61522833-61522855 ATGGAGAGCCAGAAGGTGGAGGG + Intergenic
1109438392 13:62337009-62337031 ATAGAGGGGAGGAAGGGGGAAGG - Intergenic
1109465383 13:62725690-62725712 ATGGAGTGGGGGCAGGGGGAGGG - Intergenic
1109577693 13:64283494-64283516 ATGGAAGGAAGGAAGGAGGAAGG + Intergenic
1110479886 13:75961647-75961669 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1110865645 13:80392526-80392548 AGGGAGTGAGGGAAGAAGGAAGG - Intergenic
1111086426 13:83380719-83380741 AGGGAGTGGGAGGAGGAGGAAGG - Intergenic
1111497879 13:89076913-89076935 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
1111640069 13:90957385-90957407 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1112323951 13:98431176-98431198 GTGCAGTGGCCGCAGGAGGAAGG - Exonic
1112441223 13:99426387-99426409 AGGGAGTGGAGGAATGAGGGGGG - Intergenic
1112485770 13:99818059-99818081 AAGAAGTGAGGGAAGGAGGAAGG + Intronic
1112488002 13:99836889-99836911 GTGGGGTGGGGGAAGGGGGAGGG + Intronic
1112828366 13:103418466-103418488 ATGGGGTGGGGGGAGGGGGAGGG + Intergenic
1113072909 13:106438823-106438845 ATGGATGGGTGGAGGGAGGAAGG + Intergenic
1113166272 13:107447149-107447171 AAGGAGAAGAGGAAGGAGGAAGG - Intronic
1113186124 13:107687305-107687327 ATGGAGGGAGGGAAGGAGGGAGG + Intronic
1113525730 13:110973772-110973794 ATGGAGTTGGGGAAAGAGGGTGG + Intergenic
1113591313 13:111503261-111503283 ATGGAGTGCTGGAATGAGAAGGG - Intergenic
1113674064 13:112196148-112196170 ATGGAGGGAGGGAGGGAGGAAGG - Intergenic
1113843238 13:113371783-113371805 ATGGAGGGGCCTCAGGAGGAGGG - Intergenic
1113905389 13:113817202-113817224 CTGGAGAGGAGGAAGGAGGTTGG - Intergenic
1113909938 13:113836884-113836906 GGGGAGTGGGGAAAGGAGGAGGG + Intronic
1114345164 14:21787261-21787283 GTGGAGTGGGGGGAGGAGGGAGG - Intergenic
1114490020 14:23094700-23094722 AGGGGGTGGGGGAAGGAGGAAGG + Intronic
1114492189 14:23109999-23110021 ATGAAGATGAGGAAGGAGGAAGG + Intergenic
1114529256 14:23385400-23385422 ATGTAGTGGGGTAAGGAAGAGGG + Intronic
1114548957 14:23522463-23522485 CTGGGGTGGCGGCTGGAGGAGGG + Exonic
1115084279 14:29494522-29494544 ATGGAGGGAGGGAGGGAGGAAGG + Intergenic
1115412748 14:33093968-33093990 GTGGGGTGGGGGAAGGGGGAGGG + Intronic
1115698158 14:35922949-35922971 ATGGGGTGGGGGATGGGGGAGGG + Intronic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1116808391 14:49515770-49515792 ATGGAGTGGGAGAGAGAGGAGGG + Intergenic
1117247446 14:53900180-53900202 AGGGAGGGAGGGAAGGAGGAAGG + Intergenic
1117350957 14:54881240-54881262 ATGGAGGGGCTATAGGAGGAGGG + Intronic
1117390357 14:55256544-55256566 ATGGAGAGCTGGAAAGAGGATGG - Intergenic
1117402766 14:55372598-55372620 AGGGAGGGAGGGAAGGAGGAAGG - Intronic
1118186625 14:63543488-63543510 AGGGATTGGCGGCAGGAGGGCGG + Intergenic
1118803903 14:69217681-69217703 ATGGAGTGGGGGGAGGGGGAAGG - Intronic
1118896138 14:69947137-69947159 AGGGAGTGAAGGAAGAAGGAAGG - Intronic
1118975357 14:70671708-70671730 AACGAGTGGGGGAAGGAGGCAGG - Exonic
1119201478 14:72756027-72756049 ATGGAGGTGGGGAAGGAGGATGG + Intronic
1119887694 14:78157171-78157193 ATGGAGAGGAGGAAGTAGGAGGG + Intergenic
1120018604 14:79502524-79502546 AGGGAGAGGCGGGAGGAGGTGGG - Intronic
1120055709 14:79921540-79921562 ACTGAGTGGGTGAAGGAGGAAGG + Intergenic
1120134521 14:80850051-80850073 AGGGAGGGAGGGAAGGAGGAAGG + Intronic
1120586934 14:86323087-86323109 CTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1120903171 14:89593242-89593264 AGGGAGGGAAGGAAGGAGGAAGG + Intronic
1120988539 14:90354976-90354998 ATGGGGAGGGGAAAGGAGGAGGG + Intergenic
1121055369 14:90847375-90847397 AGGGAGTGGGGGCAGGAGGGTGG + Intergenic
1121115434 14:91339648-91339670 AGGGAGTGTACGAAGGAGGAGGG + Intronic
1121585440 14:95060099-95060121 ATGGGGTGGTGGCAGGAGGATGG - Intergenic
1121734944 14:96211666-96211688 AAGGAGGAGCGGGAGGAGGAGGG - Intronic
1121780459 14:96618840-96618862 ATAGACAGGAGGAAGGAGGAGGG - Intergenic
1121800280 14:96768964-96768986 AGGGAGTGAGGGAGGGAGGAAGG - Intergenic
1121800300 14:96769042-96769064 AGGGAGTGAGGGAGGGAGGAAGG - Intergenic
1121843831 14:97156131-97156153 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
1121916725 14:97842349-97842371 AGGGAGTGAGGGAGGGAGGAGGG + Intergenic
1122233708 14:100320385-100320407 ATGGAGGGACGGATGGAGGAGGG - Intergenic
1122288893 14:100668872-100668894 ACGGAGTGGCCGCATGAGGAGGG + Intergenic
1122420223 14:101571712-101571734 AAGCAGAGGGGGAAGGAGGAGGG + Intergenic
1122856585 14:104563076-104563098 AGGGAGGGAGGGAAGGAGGAAGG + Intronic
1122958513 14:105083787-105083809 ATGGATGGGTGGAGGGAGGATGG - Intergenic
1123058823 14:105585307-105585329 ATGGAGGGGTGAATGGAGGATGG - Intergenic
1123058830 14:105585337-105585359 ATGGAAGGGTGGATGGAGGATGG - Intergenic
1123083150 14:105705533-105705555 ATGGAGGGGTGAATGGAGGATGG - Intergenic
1123083157 14:105705563-105705585 ATGGAAGGGTGGATGGAGGATGG - Intergenic
1123083163 14:105705582-105705604 ATGGGTAGGCGGATGGAGGATGG - Intergenic
1202933256 14_KI270725v1_random:59337-59359 AGGGAGGGAGGGAAGGAGGAAGG + Intergenic
1124099720 15:26682278-26682300 AGGGAGTGGGAGAGGGAGGAAGG - Intronic
1124196180 15:27631869-27631891 AGCGGGTGGTGGAAGGAGGAAGG - Intergenic
1124367998 15:29087728-29087750 CTGGAGTGGGGAAAGGAGGCAGG - Intronic
1124914090 15:33951412-33951434 AAGGGGTGGGGGAGGGAGGAGGG + Intronic
1124983916 15:34586687-34586709 ATGGGGTGGGGGGAGGGGGAGGG + Intronic
1125101514 15:35918464-35918486 AGGGATTGGGGGAAGGAAGAAGG + Intergenic
1125368857 15:38948298-38948320 GGGGAGGGGAGGAAGGAGGAGGG + Intergenic
1125451045 15:39808024-39808046 AAGGACTGGCGGAAGCGGGAGGG - Intronic
1125660619 15:41391943-41391965 CTGGTGTGGAGGAAGGAGGTAGG + Intronic
1125701487 15:41689344-41689366 AAGGAAGGGAGGAAGGAGGAGGG - Intronic
1125791143 15:42366738-42366760 ATGGAGTGGAGGAAGCAACAGGG + Intronic
1126223263 15:46239974-46239996 ATAGAGTGAAGGAAGGAGGAAGG + Intergenic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1127151856 15:56083850-56083872 GTGGGGTGGCAGAAGGAGGGAGG + Intergenic
1127507375 15:59610267-59610289 AAGGAGTGAAGGAAGGAGGGAGG - Intronic
1127507431 15:59610506-59610528 AAGGAGGGACGGAAGGAGGGAGG - Intronic
1127507474 15:59610622-59610644 ATGGAGAGAGGGAAGGAGGGAGG - Intronic
1127660744 15:61098092-61098114 AGGGAGGGAGGGAAGGAGGAAGG - Intronic
1128225635 15:65999451-65999473 ATGAGGTGGAGGAAGCAGGAAGG - Intronic
1128252239 15:66171526-66171548 ATGGAGAGGTGGGAGGAGGAGGG + Intronic
1128327981 15:66737520-66737542 TTGAATTGGAGGAAGGAGGAAGG + Intronic
1128431416 15:67598511-67598533 AAGGAGTGCAGGGAGGAGGAGGG - Intronic
1128568240 15:68715177-68715199 ATGGAGTTGAGGAAGGTGGCAGG - Intronic
1128582973 15:68821335-68821357 ACGGGGTTGCGGAAGGAGGCGGG + Intronic
1128793495 15:70449439-70449461 ATAGAGGGGTGGAAGGAGGGAGG + Intergenic
1129013380 15:72443220-72443242 ATGGGGTGGGGGAGGGGGGAGGG + Intergenic
1129306431 15:74667459-74667481 AGGGGGTGGAGGGAGGAGGAGGG + Intronic
1129332048 15:74832719-74832741 ATGGGGAGGGGGAAGGAAGAAGG - Intergenic
1129634904 15:77305188-77305210 AGGGAGGGACGGAAGGAGGGAGG + Intronic
1129663644 15:77567186-77567208 ATGGGGTGGGTGCAGGAGGAGGG + Intergenic
1129699644 15:77760246-77760268 ATGGAGAGGCTCAAGGAGGTGGG + Intronic
1129949377 15:79572434-79572456 ATGGAGGGATGGAAGAAGGAAGG + Intergenic
1130278602 15:82499063-82499085 AGGGGGTGGGGGAAGGAGGGAGG + Intergenic
1130430439 15:83842031-83842053 ATGGGGAGGCAGAAGGGGGATGG - Intronic
1130542724 15:84833484-84833506 CTGGAGAGGTGGAAGGTGGATGG + Intronic
1130667442 15:85881568-85881590 AAGGAGTAGTGGAAGGAAGAGGG - Intergenic
1130861972 15:87899373-87899395 AGGGGGTGGGGGAAGGAGAAAGG - Intronic
1130959867 15:88652484-88652506 AAGGAGGAGGGGAAGGAGGAGGG - Intronic
1130959872 15:88652496-88652518 AAGGAGGAGGGGAAGGAGGAGGG - Intronic
1131667982 15:94590576-94590598 CTGGAGTGACGGAAGGAGAAAGG - Intergenic
1132482281 16:172661-172683 GTGGAGTGGCGGGTGGAGGGTGG + Intergenic
1132483129 16:176465-176487 GTGGAGTGGCGGGTGGAGGGTGG + Intergenic
1132599717 16:768096-768118 GTGGAGGGGCGCATGGAGGAGGG + Intronic
1132834435 16:1945732-1945754 ATGGAGTGGTGGGAGCAGAAGGG - Intronic
1132873532 16:2125907-2125929 ATGGTGTTGGGGGAGGAGGAGGG - Intronic
1133431957 16:5745084-5745106 ATGAGGTGGGGGAAGGGGGAGGG - Intergenic
1133449776 16:5894075-5894097 ATGGTGTGGGTGAGGGAGGAGGG + Intergenic
1133551161 16:6855814-6855836 AAGGAGGGAGGGAAGGAGGAAGG - Intronic
1133802041 16:9092045-9092067 ATGGAGGAGCGGAAGGAGGAGGG + Exonic
1133964116 16:10518987-10519009 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
1133978132 16:10614923-10614945 AGGGAGGGATGGAAGGAGGAAGG - Intergenic
1134287978 16:12879120-12879142 ATGGAGGGAGAGAAGGAGGAAGG - Intergenic
1134552620 16:15145083-15145105 ATGGTGTTGGGGGAGGAGGAGGG - Intergenic
1134710889 16:16326517-16326539 AGGGAGGGGAGGAAGGAGGAGGG - Intergenic
1134755829 16:16666512-16666534 ATGGAGTGTCGGAAGCAGTCTGG + Intergenic
1134792167 16:16998857-16998879 ATGGACTGGGTGAAGAAGGAAGG + Intergenic
1134948712 16:18342128-18342150 GAGGAGGGGAGGAAGGAGGAGGG + Intergenic
1134990238 16:18692653-18692675 ATGGAGTGTCGGAAGCAGTCTGG - Intergenic
1135068527 16:19332228-19332250 AAGGAATGAAGGAAGGAGGAAGG + Intergenic
1135166425 16:20143050-20143072 AGGGAGTGGGGGAAAGTGGAAGG + Intergenic
1135263337 16:21000035-21000057 AGGGAGGGAGGGAAGGAGGAAGG + Intronic
1135294114 16:21264491-21264513 AGGGTGTGGGGGCAGGAGGAGGG + Intronic
1135628985 16:24021350-24021372 AGGGAGGGAGGGAAGGAGGAAGG - Intronic
1135728194 16:24873232-24873254 ATGGAGAGAGGGAGGGAGGAAGG + Intronic
1136075543 16:27814711-27814733 AGGGAGAGAGGGAAGGAGGAAGG + Intronic
1136507317 16:30713060-30713082 ATGGAGCGACAGAAAGAGGAGGG - Intronic
1137409193 16:48213588-48213610 AGGGAATGGAGGAAGCAGGAAGG - Intronic
1137542758 16:49376441-49376463 ATTGAGTGGGGGATGGTGGAAGG + Intronic
1137588983 16:49682024-49682046 AGGGAATGGAGGAAGGATGAGGG - Intronic
1137683373 16:50369421-50369443 GAAGAGTGGGGGAAGGAGGAAGG - Intergenic
1137877917 16:52014887-52014909 AGGGAGGGAAGGAAGGAGGAAGG - Intronic
1138174379 16:54883409-54883431 AGGGAGGGAGGGAAGGAGGAAGG + Intergenic
1138439960 16:57028262-57028284 ATGGTGGGGAGGAACGAGGAGGG - Intronic
1138458811 16:57135973-57135995 AAGGAGGGAGGGAAGGAGGAAGG + Intronic
1138567877 16:57846604-57846626 ATGGAGTGGGGGAGAAAGGAGGG - Intronic
1138749958 16:59407994-59408016 ATGGGGTGGGGGGAGGGGGAAGG - Intergenic
1138752678 16:59443091-59443113 ATGGGGTGGGGGGAGGGGGAAGG - Intergenic
1139124858 16:64065641-64065663 ATGGAGGGGGGGATGGAGGGAGG + Intergenic
1139147438 16:64341554-64341576 AAGGAGGGAAGGAAGGAGGAAGG - Intergenic
1139366113 16:66434460-66434482 CTGGAGTGGGGGAAGGGAGAAGG + Intronic
1139482115 16:67236488-67236510 ATGGAGGGGCGCAAAGCGGAGGG + Intronic
1140063744 16:71592543-71592565 ATGGAGAGGAGGGAGGAGAAAGG - Intergenic
1140150057 16:72353645-72353667 ATGGGGTGGGGGGAGGGGGAGGG + Intergenic
1140170405 16:72598706-72598728 ATGGAGTGGGAGAAGGGAGAGGG + Intergenic
1140266878 16:73428643-73428665 ATGGTGGGGAGGGAGGAGGAAGG - Intergenic
1140281969 16:73563340-73563362 ATGGCGTGGAGGCAGGAGAATGG - Intergenic
1140410227 16:74736760-74736782 AGGGAGTGGCAGAGGGAGGGAGG - Intronic
1140541492 16:75760312-75760334 AGGGAGGGATGGAAGGAGGAAGG - Intronic
1140814145 16:78604977-78604999 AGGGAGTGAGGGAGGGAGGAAGG - Intronic
1140894981 16:79317085-79317107 ATGGAGTGAGGGAGGAAGGAGGG - Intergenic
1140910355 16:79445641-79445663 ATGGAGTCAGGGAAGGATGAAGG + Intergenic
1140912630 16:79467836-79467858 ATGGAGGGGAGGAAGGGAGAGGG + Intergenic
1141382004 16:83585219-83585241 ATAGAGTGCAGGAAGGTGGAAGG - Intronic
1141421528 16:83920982-83921004 ATGGATGGGTGGAAGGAAGATGG + Exonic
1141514578 16:84535154-84535176 GAGGAGTGGGAGAAGGAGGAGGG - Intronic
1141850661 16:86643268-86643290 AAGGGGTGGCAGAAGGAAGATGG - Intergenic
1142211706 16:88811609-88811631 ATGGCGGCGCGGAAGGAGGCGGG + Exonic
1142274654 16:89111471-89111493 AGGGTGTGGCGGAGGGAGGAGGG - Intronic
1142614716 17:1127587-1127609 CTGGAGAGGAGGAGGGAGGAGGG - Intronic
1142708675 17:1711294-1711316 GTGGAGTGGAGTAAGGTGGAAGG - Intergenic
1143002360 17:3802645-3802667 ATGAAGTGAGGGGAGGAGGAGGG - Intergenic
1143036881 17:4004399-4004421 ACGGCGGGGCGGAGGGAGGAGGG + Intergenic
1143544406 17:7588018-7588040 CTGGGGTGGGGGAAGGGGGACGG + Exonic
1143870279 17:9953310-9953332 AAGGAGTGGCAGAAGCAGCAGGG - Intronic
1144002358 17:11067308-11067330 GTGGGGTGGGGGACGGAGGAGGG - Intergenic
1144382781 17:14719116-14719138 ATATAGTGAGGGAAGGAGGAAGG - Intergenic
1144754259 17:17669767-17669789 AGGGAGTGGGGAAGGGAGGATGG - Intergenic
1146691039 17:34876357-34876379 AGGGAGTGAGGGAAGCAGGATGG - Intergenic
1146925037 17:36738579-36738601 AGGGAGGGGAGGAAGGAGGGAGG + Intergenic
1146925046 17:36738599-36738621 AGGGAGGGGAGGAAGGAGGGAGG + Intergenic
1146935660 17:36811183-36811205 ATGGAGTGTGGGGAGCAGGAGGG - Intergenic
1147310857 17:39595498-39595520 AGGGAGGGAGGGAAGGAGGAGGG + Intergenic
1147473764 17:40689789-40689811 GTGGAGTGGGGGAAGGTGGGAGG - Intergenic
1147717542 17:42518580-42518602 CTCGAGTGGGTGAAGGAGGAAGG - Intronic
1147906343 17:43825573-43825595 ATGGGGTGGCAGCAGGAGGAGGG - Intronic
1147924693 17:43939091-43939113 GTGGAGTGGGGGAAGGTGGATGG - Intergenic
1148213873 17:45824079-45824101 CTGGACTGGGGGAAGGAGGTGGG + Intronic
1148241997 17:46005729-46005751 CTGGAGCTGCGGAAGGAGGTGGG - Intronic
1148359996 17:47003862-47003884 GTGGGGTGGAGGAAGGGGGAAGG - Intronic
1148462197 17:47845285-47845307 GTGGAGAGGGGGAAAGAGGAAGG - Exonic
1148555209 17:48574737-48574759 ATGGAGTGGGGGTAGGGGAAAGG - Intronic
1148754538 17:49965815-49965837 AAGAAGTGGGGGGAGGAGGAGGG - Intergenic
1148850962 17:50555137-50555159 ACGGTGGGGCGGAAGGAGGATGG + Intronic
1148885399 17:50768518-50768540 ATGGAGAGGCGGAAGTAGCAGGG + Intergenic
1148902330 17:50887766-50887788 ATGGAGAGTTGGGAGGAGGAAGG + Intergenic
1149407653 17:56370595-56370617 TTGGAGTGGAAGAAGGAGGGGGG + Intronic
1149452526 17:56760873-56760895 AGGGAGGGGAGGAAGGAAGAAGG + Intergenic
1149595918 17:57864635-57864657 CTGCAGTGGATGAAGGAGGATGG + Intronic
1149682060 17:58513916-58513938 ATGGAATGGTGGAAGAGGGAAGG + Intronic
1150118560 17:62578232-62578254 ATGGAGAGGAGGGAGGAGGAGGG + Intronic
1150122434 17:62615432-62615454 ATGGGGTGGGGGAGGGAAGAAGG + Intronic
1150327593 17:64269281-64269303 CTGGAGTGGAGGCAGGAGGATGG - Intergenic
1150424768 17:65068572-65068594 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
1150576252 17:66433474-66433496 ATGGAGTAGCTAAAGGAGCAGGG + Intronic
1150662947 17:67101345-67101367 ATGGAGTGGATGGGGGAGGAGGG - Intronic
1150675525 17:67244199-67244221 CTGGAGCGGGGGAAGGAGGGAGG - Intronic
1150822207 17:68444838-68444860 ATGGAGGGAGGGAAGAAGGAAGG - Intronic
1150864404 17:68834597-68834619 ATGGAGGGAGGGAGGGAGGAAGG - Intergenic
1151044932 17:70908886-70908908 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
1151360594 17:73586372-73586394 GGAGAGGGGCGGAAGGAGGAGGG - Intronic
1151479859 17:74363591-74363613 ATGCAGAGGCTGAAGGAGGCTGG - Intergenic
1151518713 17:74613652-74613674 AAGGAGTGGGGAAGGGAGGAGGG + Intronic
1151536587 17:74742309-74742331 CTGGAGTTGGGGAGGGAGGATGG + Intronic
1151657939 17:75504330-75504352 ATGGAAAGGTGGCAGGAGGAAGG + Intronic
1151784441 17:76268500-76268522 AGGGAGTAGTGGAGGGAGGAGGG + Intronic
1152035823 17:77871986-77872008 ATGGGGTGGGGGAAGGAGGAAGG + Intergenic
1152182913 17:78835756-78835778 ACTGAGTGGCGGAAGGAGCCAGG + Intronic
1152617111 17:81343071-81343093 CAGGAGTGGAGGAAGGTGGAAGG - Intergenic
1152620182 17:81359481-81359503 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
1152859083 17:82685215-82685237 ATGGGGAGGGGGAGGGAGGACGG + Intronic
1152863424 17:82709122-82709144 ATGGAGTGGGGGATGGAGCAGGG - Intergenic
1152913205 17:83017190-83017212 GGGCAGTGGCGGGAGGAGGAAGG + Intronic
1153356082 18:4137042-4137064 GTGGAGTGGGGGAAGGGGGGAGG - Intronic
1153401298 18:4686507-4686529 GTGGAGTGGGGGAAGGGGGGAGG + Intergenic
1153522011 18:5962444-5962466 AGGGAGTGGCGGGAAGAGGGAGG + Intronic
1153841028 18:9008008-9008030 ATGGGGTGGGGGAAGGGGGAAGG + Intergenic
1154238283 18:12627203-12627225 GTGGGGTGGGGGAGGGAGGAGGG - Intronic
1154343899 18:13526894-13526916 AGGAAGTGAGGGAAGGAGGAAGG - Intronic
1155521446 18:26672948-26672970 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
1155756841 18:29509145-29509167 GTGGGGTGGGGGAAGGGGGAAGG - Intergenic
1155882829 18:31170949-31170971 ATGGAGAAGATGAAGGAGGATGG + Intergenic
1156439266 18:37167445-37167467 ATGGGGTGTCAGAAGGGGGATGG + Intronic
1156492551 18:37505007-37505029 CTGCAGTGGCTGGAGGAGGATGG - Intronic
1156781747 18:40858254-40858276 AGGGAGGGACGGAGGGAGGAAGG + Intergenic
1156843818 18:41639513-41639535 AAGGAGGGAGGGAAGGAGGAAGG + Intergenic
1157231106 18:45916860-45916882 ATGGAGTTGGGGAGTGAGGAGGG - Intronic
1157498683 18:48173956-48173978 ATGGGGTGGAGGATGAAGGAGGG - Intronic
1157514270 18:48299696-48299718 ATGAAGAGGCTGAAGGAGGATGG + Intronic
1157641744 18:49221755-49221777 GTGGGGTGGGGGAAGGAGGGAGG + Intronic
1157646788 18:49281802-49281824 GTGGAGTGGGGGCAGGGGGAAGG + Intronic
1157974192 18:52307327-52307349 ATGGAGTGGGGGGAGGAGGGAGG + Intergenic
1158195702 18:54882891-54882913 ATGGAGTGGTGATAGGAGTAGGG + Intronic
1158911149 18:62063927-62063949 ATGGGGTGGGGGGAGGGGGAAGG + Intronic
1158938233 18:62384480-62384502 AAGGAGTGGAGGAGGGAGGGGGG - Intronic
1159046918 18:63377597-63377619 AAGGAAGGGGGGAAGGAGGAAGG - Intergenic
1159322965 18:66877501-66877523 AGGGAGGGAGGGAAGGAGGAAGG + Intergenic
1159512648 18:69416111-69416133 ATGGAGGGAGGGACGGAGGAAGG + Intronic
1159610146 18:70515791-70515813 ATGGGGTGGGGGGAGGGGGAGGG - Intergenic
1160322053 18:77905505-77905527 ATGGACAGGTGGAAGGTGGAAGG + Intergenic
1160378411 18:78430849-78430871 AGTGAGAGGCGGAGGGAGGAAGG - Intergenic
1160958282 19:1705441-1705463 ATGGAGGGAGGGAGGGAGGAAGG + Intergenic
1161122890 19:2539892-2539914 AGGGAGGGAGGGAAGGAGGAAGG - Intronic
1161329013 19:3677745-3677767 ATGGAGGGAGGGATGGAGGATGG + Intronic
1161329116 19:3678061-3678083 ATGGAGAGATGGAAGGAGAATGG + Intronic
1161389763 19:4014919-4014941 AGGAAGTGGAGGAGGGAGGAAGG + Intronic
1161517985 19:4707355-4707377 AGGGAATGGCAGAAGCAGGATGG + Intronic
1161638082 19:5401839-5401861 AGGGAGGGAGGGAAGGAGGAAGG + Intergenic
1161910737 19:7191868-7191890 AAGGAGGGAAGGAAGGAGGAAGG + Intronic
1162078828 19:8206827-8206849 AGGCAATGGAGGAAGGAGGAGGG + Intronic
1162155920 19:8677891-8677913 ATGGAAAGGAGGAAGGAAGAGGG - Intergenic
1162232562 19:9279861-9279883 AGGGAGGGAGGGAAGGAGGAAGG + Intergenic
1162540807 19:11294890-11294912 ATGGATTGGGGGAAGGCGGATGG - Intergenic
1162567924 19:11454291-11454313 CTGGGGTGGGGGCAGGAGGATGG + Exonic
1162766507 19:12923035-12923057 CTGGTGTGGCTGAAGGCGGAGGG - Intronic
1162814851 19:13187553-13187575 AGGGAGGGAAGGAAGGAGGAAGG - Intergenic
1162918125 19:13885123-13885145 AGGGAGTGACGGCAGGAGGCAGG + Intronic
1163207213 19:15812495-15812517 AGGGAGGGAGGGAAGGAGGAAGG + Intergenic
1163462556 19:17447958-17447980 ATGGAGGGAGGGAAGGAGGGAGG + Intronic
1163499364 19:17666708-17666730 AAGGGGTGGAGGAAGGAGAAAGG + Intronic
1163703184 19:18797101-18797123 AGGGAGAGGGGGAGGGAGGAAGG - Intergenic
1164499817 19:28808632-28808654 ATGGGGTGGGGGGAGGAGGGAGG + Intergenic
1164522242 19:28988441-28988463 AGGGAGTGGGGGAGGGAGGGAGG + Intergenic
1164688106 19:30184799-30184821 ATGGGGTGGGGGGAGGGGGAAGG - Intergenic
1164731051 19:30504577-30504599 TTGGAGAGAGGGAAGGAGGAAGG - Intronic
1164763183 19:30743568-30743590 AAGGAGAGGAGGAAGAAGGAAGG - Intergenic
1164766028 19:30770648-30770670 GTGGGGTGGCGGGAGGAGGGAGG + Intergenic
1164790353 19:30972298-30972320 TTGGAGTGGGTGAGGGAGGAGGG - Intergenic
1164800681 19:31073687-31073709 ACGGAGTGGAGAAAGGAGGGAGG - Intergenic
1165564163 19:36709491-36709513 CTGGAGTGGGGGAAGGGGAAGGG - Intronic
1165603208 19:37076515-37076537 AGGGAGTGGGGGTAGGGGGAGGG - Intronic
1166062435 19:40335003-40335025 AGGGAGGGAGGGAAGGAGGAAGG + Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166273844 19:41737128-41737150 ATGGGGTGGGGGTAGGAGGGAGG + Intronic
1166350292 19:42194894-42194916 AGGGAGGGAGGGAAGGAGGAAGG + Intronic
1166979659 19:46625104-46625126 AGGGAGGGACGGAGGGAGGAGGG - Exonic
1167019260 19:46861550-46861572 ATGGAGGGGTGGAAGGGGGAAGG - Intergenic
1167195111 19:48023152-48023174 AGGGAGGGAAGGAAGGAGGAAGG + Intronic
1167195181 19:48023413-48023435 AGGGAGGGAGGGAAGGAGGAAGG + Intronic
1167360688 19:49028786-49028808 AGGCAGTGGATGAAGGAGGATGG + Intronic
1167362966 19:49040020-49040042 AGGCAGTGGATGAAGGAGGATGG - Intergenic
1167389454 19:49184563-49184585 ATGGCGTGGAGGCAGGAGAATGG - Intronic
1167501423 19:49850930-49850952 ATGGGGTGGCAGAAGAACGAAGG - Intronic
1167714981 19:51137396-51137418 AGGGAATGGAGGGAGGAGGAAGG - Intergenic
1168075478 19:53978869-53978891 AGGGAGGGAGGGAAGGAGGAAGG + Intronic
1168119403 19:54243148-54243170 ATGGACGGGCTGAAGGAGGGAGG - Intronic
1168125620 19:54280913-54280935 ATGGATGGGCTGAAGGAGGGAGG - Intronic
1168130224 19:54312969-54312991 ATGGACGGGCTGAAGGAGGGAGG - Intronic
1168168857 19:54573461-54573483 ATGGACGGGCTGAAGGAGGGAGG + Intronic
1168185182 19:54696017-54696039 ATGGATGGGCTGAAGGAGGGAGG + Intronic
1168290102 19:55353399-55353421 ATGGAGAGGGAGAAGGGGGACGG + Intronic
1168602429 19:57728437-57728459 TTGGAGTGGAAGAAGGAAGAGGG + Intronic
925083067 2:1084821-1084843 CTTGGGTGGCGGGAGGAGGAAGG + Intronic
925163266 2:1701611-1701633 ATGGGGTGGGGGACGCAGGATGG + Intronic
925477902 2:4239100-4239122 GTGGAGTGGGGGGAGGGGGAAGG + Intergenic
925791044 2:7488631-7488653 AGGGAGGGAAGGAAGGAGGAAGG + Intergenic
925791088 2:7488782-7488804 AGGGAGGGAAGGAAGGAGGAAGG + Intergenic
925791194 2:7489146-7489168 AGGGAGGGAAGGAAGGAGGAAGG + Intergenic
925833069 2:7915404-7915426 GGGGAGTGGAGGAAGGAGGATGG - Intergenic
926238319 2:11066804-11066826 ATGGGATGGGGGAAGGAGGGAGG - Intergenic
926291986 2:11538852-11538874 AGGGAGGGACGGAGGGAGGAAGG - Intronic
926366075 2:12134042-12134064 ATGGAGAGAGGGAAGGAGGATGG - Intergenic
926559126 2:14395680-14395702 GTGGGGTGGCGGGAGGAGGGAGG + Intergenic
926821014 2:16851824-16851846 AGGGAGGGGAGGAGGGAGGAAGG - Intergenic
926866874 2:17370016-17370038 TTGGAGTGGGGGGAGGGGGAGGG - Intergenic
926947690 2:18206136-18206158 AGGGAGTGAGGGAAGGAGGGAGG - Intronic
926947698 2:18206159-18206181 AGGGAGGGAGGGAAGGAGGAAGG - Intronic
927039126 2:19210416-19210438 GTGGGGTGGGGGAAGGGGGAAGG - Intergenic
927855824 2:26527471-26527493 CTGGAGAGGCGAAAGGTGGAGGG - Intronic
928598495 2:32880293-32880315 ATGGGGTGGGGGAGGGGGGAGGG + Intergenic
928718762 2:34095067-34095089 ATGGGGTGGGGGGAGGGGGAGGG - Intergenic
929401874 2:41592232-41592254 AGGGAGGGAGGGAAGGAGGAAGG + Intergenic
929439278 2:41952681-41952703 ATGTGCTGGCGGAAGGAGGCTGG - Intronic
929457775 2:42078150-42078172 ATGGAGTGGGGTAGGGTGGAGGG - Intergenic
930267398 2:49215783-49215805 ATGGGGTGGGGGCAGGGGGAGGG + Intergenic
930352660 2:50277432-50277454 AGGGAGAGAGGGAAGGAGGAAGG - Intronic
930563288 2:52987809-52987831 GTGGGGTGGGGGAAGGAGGGAGG - Intergenic
930654205 2:53992091-53992113 AGGGAGGGAGGGAAGGAGGAAGG - Intronic
930767353 2:55097555-55097577 CAGCAGTGGGGGAAGGAGGAGGG + Intronic
930835401 2:55788259-55788281 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
930838488 2:55819985-55820007 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
931093512 2:58913558-58913580 ATGGGGTGGAGGGAGAAGGAGGG - Intergenic
931115142 2:59157865-59157887 AGGGAGGGAGGGAAGGAGGAAGG + Intergenic
931121627 2:59226391-59226413 AGGGAGGGAGGGAAGGAGGAAGG + Intergenic
931121649 2:59226452-59226474 AGGGAGGGAGGGAAGGAGGAAGG + Intergenic
931781129 2:65580134-65580156 ATGGAGGGGGAGAAGGAGGATGG - Intergenic
931800450 2:65753122-65753144 ATGGGGTGGGGGGAGGAGGGAGG - Intergenic
931972378 2:67603135-67603157 TTTGAGTGGCGAAAGTAGGAAGG + Intergenic
932464042 2:71902012-71902034 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
932577109 2:72968723-72968745 AGGGAGGGAGGGAAGGAGGAAGG - Intronic
933070103 2:77846229-77846251 ATGGGGTGGGGGGAGGGGGAAGG + Intergenic
933141438 2:78795743-78795765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
933211785 2:79579199-79579221 AGGGAGGGAGGGAAGGAGGAAGG - Intronic
933871921 2:86574954-86574976 TTGGGGTGTGGGAAGGAGGATGG - Intronic
933946265 2:87288610-87288632 ATGGAGGGAGGGAAGGAGGGAGG - Intergenic
934583599 2:95468131-95468153 ATGGTGTGCCAGAAGGGGGATGG + Intergenic
934595853 2:95608583-95608605 ATGGTGTGCCAGAAGGGGGATGG - Intergenic
934736860 2:96694010-96694032 AAGGAGTTGGGGAAGGAAGAGGG + Intergenic
934786921 2:97016905-97016927 ATGGTGTGCCAGAAGGGGGATGG + Intronic
934891845 2:98077634-98077656 ATGGGGTGGGGGGAGGGGGAGGG + Intergenic
934972083 2:98771953-98771975 ATGGAGGGACGGAAGGGGCAGGG - Intergenic
935147837 2:100408321-100408343 ATGGAGTGGCGGAAGGAGGAGGG - Intronic
935570154 2:104651235-104651257 AGGGAGGGAGGGAAGGAGGAAGG + Intergenic
936014852 2:108950235-108950257 ATGGAGGGAGGGAGGGAGGAGGG - Intronic
936159743 2:110075784-110075806 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
936184922 2:110295569-110295591 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
936487387 2:112937960-112937982 AAGGAGTGGGTGATGGAGGAAGG + Intergenic
936528362 2:113257701-113257723 AGGAAGTGGGGGAAGGAGGGAGG + Intronic
936661439 2:114548042-114548064 ATGGAGTGGGGTGAGGAGGTTGG + Intronic
936679850 2:114757346-114757368 AGGGAGAGGGGGAGGGAGGAGGG + Intronic
936820085 2:116510127-116510149 ATGGAAAGGGGGAAAGAGGAAGG - Intergenic
936912766 2:117609880-117609902 AGGGAGGGACGGAAGGAGGGAGG + Intergenic
937064513 2:119007044-119007066 CTGGAGTAGTGGAAGGAAGAAGG - Intergenic
937509926 2:122583654-122583676 ATGGAGGGAGGGAGGGAGGAAGG + Intergenic
937509998 2:122584425-122584447 ATGGGGTGGGGGAAGGGGGAGGG + Intergenic
937690433 2:124749342-124749364 ACGGAGAGAGGGAAGGAGGAGGG - Intronic
937835893 2:126469971-126469993 ATAGAGTGGGGCAGGGAGGAGGG - Intergenic
938026830 2:127956553-127956575 ATGGGGTGGGGGGAGGGGGAGGG + Intronic
938064503 2:128273712-128273734 ATGCAATGGAGGAAAGAGGACGG - Intronic
938173436 2:129103112-129103134 ATGGCTTGGAGGATGGAGGAAGG - Intergenic
938671161 2:133588309-133588331 AGGGAGGGGAGGAAGGGGGAGGG - Intergenic
938671213 2:133588470-133588492 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
938958375 2:136319385-136319407 GCGGAGTGGAGGAAGGGGGAAGG - Intergenic
939056111 2:137366240-137366262 ATGGGGTGGGGGGATGAGGATGG + Intronic
939284602 2:140112709-140112731 AGGGAGAGAAGGAAGGAGGATGG + Intergenic
939409637 2:141807917-141807939 ATGGAGTGGACATAGGAGGATGG + Intronic
939430591 2:142100919-142100941 AGGGAGAGAGGGAAGGAGGAAGG + Intronic
939833040 2:147095479-147095501 AGGGAATGTGGGAAGGAGGATGG + Intergenic
939961720 2:148571229-148571251 AGGGAGTGACGGAAGCAGGGTGG + Intergenic
940619385 2:156092110-156092132 ATAGTGTGGGGGAAGGAGAAAGG - Intergenic
941248017 2:163124959-163124981 GTGGAGTGGGGGAAGGGGGGAGG + Intergenic
941282287 2:163567934-163567956 AAGGAGGGAGGGAAGGAGGAAGG + Intergenic
941515582 2:166472104-166472126 AAGGAGTGGGGGGAGGGGGAGGG - Intronic
941670105 2:168283961-168283983 CTGGAGGGACGGAAGGAGGAGGG + Intergenic
942431837 2:175920295-175920317 ATGGGGTGGGGGAAGGGGGAGGG + Intergenic
942570914 2:177313413-177313435 AAGGAGGGAGGGAAGGAGGAAGG - Intronic
942748852 2:179265135-179265157 GTGGTGTGGCTGAAGGATGAAGG + Intergenic
942946623 2:181680741-181680763 ATGCCGGGGAGGAAGGAGGAGGG - Exonic
943159411 2:184228341-184228363 ATGGAGTGGGGGGAGGGGGAGGG - Intergenic
943214214 2:185009823-185009845 ATGGAGGTGTGGAAAGAGGAAGG - Intergenic
943549861 2:189325166-189325188 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
944001965 2:194850701-194850723 ATGGAGTGGGGGGAGGGGGGAGG - Intergenic
944329592 2:198449950-198449972 ATGGGGTGGGGGAGGGGGGAGGG - Intronic
944635254 2:201670119-201670141 ATGGAGAGAGGGAGGGAGGAAGG + Intronic
944927469 2:204479760-204479782 ATGGTGTGGGGGAGGGGGGAAGG - Intergenic
945311818 2:208322837-208322859 ATGGGGTGGGGGAGGGGGGAGGG - Intronic
945343005 2:208680493-208680515 ATGGGGTGGGGGGAGGGGGAGGG - Intronic
945350017 2:208766131-208766153 ATGGGGTGGGGGGAGGGGGAGGG + Intronic
945460609 2:210103319-210103341 ATGGGGTGGGGGAAGGGGGGAGG + Intronic
945911205 2:215651509-215651531 AGGGAGGGAGGGAAGGAGGAAGG + Intergenic
945958227 2:216105967-216105989 AGGGAGGGAGGGAAGGAGGAAGG + Intergenic
946210469 2:218143535-218143557 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
946283422 2:218683726-218683748 GTGGGGTGGGGGAAGGGGGAGGG - Intronic
946400610 2:219466508-219466530 ATGGAGGGGCCCAAGGAGCAGGG + Intronic
946719617 2:222590364-222590386 ATGGGGTGGGGGAAGGGGGAGGG + Intronic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
946925510 2:224622835-224622857 ATGGGGTGGGGGGAGGGGGAGGG + Intergenic
946982517 2:225232992-225233014 TTGGAGTGGCGTGAGGAGCATGG + Intergenic
947042749 2:225942346-225942368 ATGGAGGGAGGGAAGGAGGGAGG + Intergenic
947129167 2:226903988-226904010 ATGGGGAGGTGGAAGAAGGATGG - Intronic
947590316 2:231381507-231381529 AGGGAGTGGAGGATGGAGGAGGG - Intergenic
948021902 2:234740368-234740390 AGGGAGTGGCGGCAAGGGGAGGG + Intergenic
948079322 2:235192612-235192634 GTGGGGTGGGGGAGGGAGGAGGG - Intergenic
948080329 2:235200338-235200360 AGGGAGGGAGGGAAGGAGGAGGG + Intergenic
948326824 2:237128426-237128448 ATGGGGTGGCGGGAGGGGGAGGG + Intergenic
948526819 2:238575936-238575958 GCGCAGTGGCTGAAGGAGGAGGG - Intergenic
948670350 2:239564480-239564502 ATGGAAGGGGGGAAGGAGAAGGG - Intergenic
948695652 2:239732009-239732031 GTGGAGGGGAGGAAGGAGGGTGG - Intergenic
949016853 2:241718344-241718366 AGGGAGGGAGGGAAGGAGGAAGG - Intronic
1168974365 20:1953096-1953118 ATGGAGGGAGGGAGGGAGGAAGG + Intergenic
1169004039 20:2192216-2192238 GTGGAGAGGAGGAAGGATGACGG - Intergenic
1169038088 20:2470199-2470221 ATGGAGAGGAGGGCGGAGGAGGG - Intronic
1169118830 20:3083539-3083561 AGGGCGAGGAGGAAGGAGGAAGG - Intronic
1169144319 20:3242480-3242502 GTGGAATGGAGGATGGAGGATGG - Intergenic
1169342877 20:4809745-4809767 AGGGAGTGGGGGAGGCAGGACGG + Intronic
1169507910 20:6233063-6233085 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
1169547504 20:6665663-6665685 ATGGAGGGACGGAGGGAGGGAGG - Intergenic
1170000934 20:11612613-11612635 AGGGAGAGAGGGAAGGAGGAAGG - Intergenic
1170148091 20:13199390-13199412 ATGGAGGGAGGGAAGGAGGACGG - Intergenic
1170503240 20:16996554-16996576 ATGGAGGGAAGGAAAGAGGATGG - Intergenic
1170670309 20:18426721-18426743 ATGGGGTGTGGGAAGGTGGAGGG + Intronic
1170796637 20:19553026-19553048 AAGGAGGGAGGGAAGGAGGAAGG - Intronic
1171190391 20:23155011-23155033 AGGGAGGGAGGGAAGGAGGATGG + Intergenic
1171202663 20:23254627-23254649 AAGGAGGGAGGGAAGGAGGAAGG + Intergenic
1171209047 20:23302904-23302926 ATGGAGAGGTTGAAGGAGAAGGG + Intergenic
1171768678 20:29303966-29303988 GTGGAGTGGGGGAGGGGGGAGGG - Intergenic
1172608217 20:36230067-36230089 GTGGGGTGGGGGAAGGGGGAAGG - Exonic
1172692035 20:36796734-36796756 GTGGGGTGGCGGCAGGAAGAGGG + Intronic
1172788654 20:37487205-37487227 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
1172872261 20:38143126-38143148 AAGGAGTGGAGGAAGGAGAGAGG + Intronic
1173084954 20:39907012-39907034 ATGGTGTGATGGAAGGAGAATGG + Intergenic
1173290755 20:41712912-41712934 ATGGACTGGCTACAGGAGGAGGG - Intergenic
1173662671 20:44745396-44745418 AGGGAGGGACGGAGGGAGGAAGG + Intergenic
1173662679 20:44745416-44745438 AGGGAGGGACGGAGGGAGGAAGG + Intergenic
1173662687 20:44745436-44745458 AGGGAGGGACGGAGGGAGGAAGG + Intergenic
1174060280 20:47827488-47827510 CAGGAGTGGAGCAAGGAGGATGG - Intergenic
1174071617 20:47903882-47903904 CAGGAGTGGAGCAAGGAGGATGG + Intergenic
1174152432 20:48494753-48494775 CAGGAGTGGAGCAAGGAGGATGG - Intergenic
1174473352 20:50777911-50777933 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
1174478098 20:50811531-50811553 ATGGAGTGGCAGGGAGAGGAGGG - Intronic
1174692081 20:52516086-52516108 AGGGAGGGAGGGAAGGAGGAAGG + Intergenic
1174704429 20:52640975-52640997 GTGGGGTGGCGGAAGGGGGGAGG + Intergenic
1174781974 20:53397979-53398001 ATGGAGTGGGGGGAGGGGGAAGG + Intronic
1175148922 20:56917623-56917645 CTGGAGTGGGAGAAGGAAGACGG - Intergenic
1175219195 20:57407326-57407348 ATGGAGTGGAGGAGGGAGCCTGG + Intronic
1175293685 20:57894701-57894723 AAGGAGGGAGGGAAGGAGGAAGG + Intergenic
1175651169 20:60724523-60724545 ATGGAGGGAAGGAAGGGGGAAGG + Intergenic
1175657774 20:60786927-60786949 AAGGGGAGGAGGAAGGAGGAGGG - Intergenic
1175727119 20:61326106-61326128 ATAGAGTGGAGGATGGAGTAAGG + Intronic
1175780199 20:61677188-61677210 CTGGAGTAGGGGAAGGAGCAGGG + Intronic
1175934815 20:62509774-62509796 ATGGAGGGGTGGAGGGTGGAGGG - Intergenic
1175935126 20:62510636-62510658 ATGGAGAGGTGGAGGGTGGAGGG - Intergenic
1176097065 20:63349146-63349168 ATGGGCTGGTGGCAGGAGGACGG - Intronic
1176231357 20:64034637-64034659 ATGGAGAGACGGAAGCATGAGGG + Intronic
1176292331 21:5052766-5052788 ATGGAAGGATGGAAGGAGGAGGG - Intergenic
1176594659 21:8681510-8681532 AGGGAGGGAGGGAAGGAGGAAGG + Intergenic
1176892296 21:14332501-14332523 AGGGAGGGAGGGAAGGAGGAGGG + Intergenic
1176893362 21:14345994-14346016 AGGGAGGGAGGGAAGGAGGAAGG + Intergenic
1176916115 21:14627126-14627148 ATGGGGTGGGGGTAGGGGGAAGG + Intronic
1176930036 21:14798845-14798867 ATGGTATGGAGGAAGGTGGATGG - Intergenic
1177003384 21:15640742-15640764 ACGGAGGGAGGGAAGGAGGAAGG - Intergenic
1177618557 21:23556951-23556973 ATGTAGTGGTGGAATGTGGAAGG - Intergenic
1177659295 21:24062407-24062429 ATGGCGTGGAGGCAGGAGAATGG - Intergenic
1177838505 21:26211609-26211631 GTGGAGTCGGGGTAGGAGGAGGG + Intergenic
1177864864 21:26500457-26500479 AGGAAGTGGTGCAAGGAGGAAGG + Intronic
1178191521 21:30287523-30287545 ATGGAGGGAGGGAAGAAGGAAGG + Intergenic
1178275635 21:31234325-31234347 AGGGAGGGAGGGAAGGAGGAAGG + Intronic
1178278118 21:31257608-31257630 ATGGATTGATGGAAGGAAGATGG - Intronic
1178420986 21:32443015-32443037 AGGGAGGGAAGGAAGGAGGAAGG + Intronic
1178827403 21:36028378-36028400 ATGTAATGGCGAGAGGAGGAGGG - Intergenic
1178922999 21:36751646-36751668 AGGGAGTGGTGGAAGTAGGAAGG - Exonic
1179864929 21:44210892-44210914 ATGGAAGGATGGAAGGAGGAGGG + Intergenic
1179951880 21:44712831-44712853 ATGGAGGGAGGGAAGGAGAAAGG + Intergenic
1180012143 21:45058450-45058472 GTGGCGTGGAGGAAGGAGGGTGG + Intergenic
1180059091 21:45375504-45375526 ATGGAGGAGGGGGAGGAGGAGGG + Intergenic
1180277511 22:10658639-10658661 AGGGAGGGAGGGAAGGAGGAAGG + Intergenic
1181161716 22:20963706-20963728 ATGGAGGGCTGGAAGCAGGAGGG - Intergenic
1181422333 22:22810645-22810667 AAGGAGAGGCAGAGGGAGGAGGG - Intronic
1181456955 22:23065217-23065239 AGGGAGTGGGGGAAGAAGGTTGG - Intronic
1181780469 22:25189256-25189278 ATGGTGTGGAGGCAGGAGAATGG - Intronic
1181844762 22:25698203-25698225 AGGGAGGGAAGGAAGGAGGAAGG + Intronic
1181885311 22:26017379-26017401 AGGGAGAGGAGGAAGGAGGAGGG - Intronic
1181958392 22:26604963-26604985 AGGGAGTGGAGGAAAGAGGGAGG - Intronic
1181963267 22:26638346-26638368 AAGGAGTGGAGGAAGGAGGGAGG + Intergenic
1182092105 22:27602833-27602855 AGGGAGTGGCGGCAGTAGGGTGG + Intergenic
1182329836 22:29543380-29543402 ATGGGGAGGAGGAAGGAGGAAGG + Intronic
1182754433 22:32667279-32667301 AGGGAGGGAGGGAAGGAGGAAGG - Intronic
1182890863 22:33817887-33817909 ATGGAGAAGCTGAAGGAGGGAGG + Intronic
1182931386 22:34177480-34177502 AGGGAGAGGTGGAAGGAGGAGGG - Intergenic
1183343657 22:37295310-37295332 AAGGAGTGGCGGGCGCAGGATGG - Intronic
1183383722 22:37503276-37503298 CTGGTGTGGGGGCAGGAGGAGGG - Intronic
1183613053 22:38923682-38923704 AGGGAGGAGAGGAAGGAGGAAGG - Intergenic
1183698824 22:39438236-39438258 AGGGAGGGAAGGAAGGAGGAAGG - Intergenic
1183868225 22:40721140-40721162 GTGGGGTGGGGGAAGGATGAGGG - Intergenic
1184254288 22:43278333-43278355 AAGGAGTGGCTGAAGAAGGCAGG + Intronic
1184313771 22:43666289-43666311 ATGGACTGGAGGACGGAGCAGGG - Intronic
1184341918 22:43890950-43890972 CTGCAGGGGCGGAAGGAGGGAGG - Intronic
1184477857 22:44731035-44731057 ATAGTGTGGGGGAAGGAGGGAGG + Intronic
1184538742 22:45105806-45105828 CTGGAGTGGAGGCAGGAGGAGGG + Intergenic
1184562929 22:45273857-45273879 AAGAAGTGGCGGAAGGTGGCGGG - Intergenic
1185001443 22:48248941-48248963 AGGGAGAGACGGAGGGAGGAAGG - Intergenic
1185154586 22:49185551-49185573 ATGGAATGGTGGATGGTGGATGG - Intergenic
1185229842 22:49673620-49673642 AGGGAGAGGGGGAAGGGGGAGGG + Intergenic
949918577 3:8984176-8984198 AGGGAGTGGGTGAAGGGGGAGGG + Exonic
950622710 3:14218763-14218785 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
950630115 3:14276673-14276695 CTGGAGGTGAGGAAGGAGGAAGG + Intergenic
951134599 3:19089880-19089902 ATGGAGGGAAGGAAGAAGGAAGG + Intergenic
951179166 3:19638643-19638665 GTGGGGTGGGGGAGGGAGGAGGG + Intergenic
951193533 3:19798500-19798522 ACGGAGGGAGGGAAGGAGGAAGG + Intergenic
951442343 3:22737878-22737900 ATGGGGTGGGGGAAGGGGGGAGG - Intergenic
951474151 3:23087454-23087476 GTGGGGTGGCGGCAGGAGGGAGG - Intergenic
951494457 3:23310999-23311021 GTGGGGTGGCGGCAGGAGGGAGG - Intronic
951658634 3:25037364-25037386 ATGGGGTGGAGGGAGGAGGGAGG + Intergenic
952164619 3:30733632-30733654 AGGGAGGGAGGGAAGGAGGAAGG - Intronic
952469051 3:33625191-33625213 ATGGGGTGGGGGAGGGGGGAGGG + Intronic
952613516 3:35240711-35240733 GTGGGGTGGGGGAAGGAGGGAGG + Intergenic
952708289 3:36402287-36402309 ATGGAGGGGAAGAAGAAGGAAGG + Intronic
953347840 3:42190792-42190814 ATGGAGGGAGGGAGGGAGGAAGG - Intronic
953418812 3:42739344-42739366 ATGTATTGGGGGAAGGAGGTGGG - Intronic
953536136 3:43778197-43778219 ATGTAGTGGTGGGAGGAGGGAGG + Intergenic
954504214 3:51053008-51053030 TTGGGGTGGAGGATGGAGGAAGG + Intronic
955011654 3:55022623-55022645 AAGGAGGGAAGGAAGGAGGAAGG - Intronic
955029746 3:55204774-55204796 ATGGATAGAGGGAAGGAGGAGGG - Intergenic
955058262 3:55474755-55474777 ATGGAGGGGAGGTAGGAGGTGGG + Intronic
955162638 3:56479791-56479813 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
955555696 3:60134939-60134961 ATGGAGTAGAGGAAAGAGAAAGG + Intronic
956190374 3:66602209-66602231 ATGGAGGGAGGGAAGGAGGGAGG - Intergenic
957171725 3:76745975-76745997 TTGGGGTGGGGGAAGGAGGGAGG - Intronic
957526366 3:81383601-81383623 ATGCAGTTACTGAAGGAGGAGGG + Intergenic
957540575 3:81563916-81563938 AGGGAGTGAGGGAGGGAGGAAGG + Intronic
957553558 3:81736960-81736982 ATGGAGTAGTAGAAGCAGGAAGG + Intronic
957713395 3:83893325-83893347 ATGGGGTGGGGGGAGGGGGAAGG + Intergenic
957762971 3:84583683-84583705 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
957822583 3:85398148-85398170 ATGGGGTGGGGGAAGGGGGGAGG - Intronic
957894447 3:86403309-86403331 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
957980582 3:87504654-87504676 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
958254365 3:91308178-91308200 GAGGAGTGGGGGAAGGAGAAGGG + Intergenic
958506397 3:94984249-94984271 GTGGAGTGGGGGAAAGGGGAAGG - Intergenic
958564180 3:95786504-95786526 GTGGGGTGGGGGAAGGAGGTAGG + Intergenic
958717985 3:97809812-97809834 ATGGAAGGAAGGAAGGAGGAAGG + Intergenic
958877735 3:99635039-99635061 ATGGAGAGGAGGGATGAGGAGGG - Intergenic
959014234 3:101114313-101114335 TTGGGGTGGGGGAAGGGGGAAGG + Intergenic
959471079 3:106750967-106750989 ATGGGGTGGGGGCAGGAGGTTGG + Intergenic
959724383 3:109527339-109527361 ATGGGGTGGTGGAGGGTGGAGGG + Intergenic
959934144 3:112012271-112012293 AGGGAGGGAGGGAAGGAGGAAGG - Intronic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960019194 3:112930870-112930892 GTGGAGTGGCGGAAGGAGCATGG - Intronic
960168472 3:114431037-114431059 ATGGAGGGGCACAGGGAGGAGGG - Intronic
960209098 3:114938011-114938033 ATGGCGTGGAGGCAGGAGAATGG + Intronic
960311380 3:116120408-116120430 AAGGAGGGAGGGAAGGAGGAAGG + Intronic
960340234 3:116466197-116466219 AGGGAGTGGGGGAAGGAAGTAGG - Intronic
960452388 3:117826470-117826492 AGGGAGGGACGGAGGGAGGAAGG + Intergenic
960610495 3:119550923-119550945 ATGGAGGGGGGCAGGGAGGATGG - Intronic
960636821 3:119792618-119792640 CTGGAGTGGAGGCAGAAGGAAGG - Intronic
960766321 3:121134547-121134569 ATGGGGTGGGGGAAGGGGGGAGG - Intronic
960863023 3:122171123-122171145 GTGGGGTGGGGGAAGGGGGAAGG - Intergenic
961340137 3:126212328-126212350 AAGGAGGGAAGGAAGGAGGAAGG + Intergenic
961514376 3:127423562-127423584 AGAGAGTGGCAGACGGAGGAGGG - Intergenic
961623118 3:128240142-128240164 ATGGAGTTGGGGAAGGGGAAAGG - Intronic
962013288 3:131414822-131414844 ATGGAATGGGGAAAGGATGAAGG + Intergenic
962389928 3:134962792-134962814 ATGAAGAGGGGGCAGGAGGAGGG - Intronic
962821459 3:139051614-139051636 GTGGGGTGGGGGGAGGAGGAGGG - Intronic
962830642 3:139136318-139136340 TTGGAGTGGATGTAGGAGGAAGG + Intronic
962931580 3:140042665-140042687 ATGGTGTAGCGGGAGGAGGGAGG - Intronic
963234713 3:142945532-142945554 ATGGGGAGGTGGAAGGGGGATGG + Intergenic
963706063 3:148689907-148689929 GTGGGGTGGGGGAAGGGGGAAGG - Intergenic
963749885 3:149165750-149165772 AGGGAGTGGGGGCAGTAGGAAGG - Intronic
963871591 3:150421224-150421246 ATGGAGTGACTCAAAGAGGAAGG - Intronic
963997628 3:151728887-151728909 ATGGAGTGGGGGGAGGGGGGAGG - Intergenic
964842551 3:161010144-161010166 ATGGGGTGGGGGGAGGAGGAGGG - Intronic
965094740 3:164210649-164210671 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
965518342 3:169646307-169646329 ATGGGGTGGGGGGAGGGGGAGGG + Intronic
965635231 3:170773913-170773935 ATGTAGTGGGGGAAAGAGGTTGG + Intronic
966191264 3:177273784-177273806 ATGGAGTGGGGGAAGGGGGGAGG - Intergenic
966272644 3:178126296-178126318 AGGGAGGGAAGGAAGGAGGAAGG + Intergenic
966302444 3:178494849-178494871 ATGGGGTGGCTGAGGGAGAATGG - Intronic
966480345 3:180401331-180401353 ATGGAGTGGGGTCAGGGGGATGG - Intergenic
966646605 3:182252512-182252534 CTGGAGAGGTGGAGGGAGGAAGG + Intergenic
967217074 3:187219950-187219972 ATGGATAGGCCGAAGGAGGGGGG + Intronic
967221578 3:187252123-187252145 AGGTAGTGGCTGAGGGAGGAGGG - Intronic
967350735 3:188511227-188511249 AGGGAGTGAGGGAGGGAGGAAGG - Intronic
967507565 3:190270356-190270378 GTGGAGTGGGGGAAGGGGGGAGG + Intergenic
967748471 3:193086457-193086479 ATGGGGTGGGGGAGGGGGGAGGG - Intergenic
967812917 3:193775542-193775564 AGGGAGTGGCAGTTGGAGGATGG - Intergenic
967838650 3:193985805-193985827 ATGGCGTGGAGGCAGGAGAATGG - Intergenic
967949675 3:194831206-194831228 ATGGAGTCAAGGAAGGAGGGAGG + Intergenic
968163310 3:196444618-196444640 AGGGAGGGAGGGAAGGAGGAAGG + Intergenic
968530059 4:1086813-1086835 ATGGGGTGGGGGAGAGAGGATGG + Intronic
968530095 4:1086908-1086930 ATGGGGTGGGGGCAAGAGGATGG + Intronic
968530129 4:1087003-1087025 ATGGGGTGGGGGAGAGAGGATGG + Intronic
968695029 4:2020208-2020230 AGGGAGAGAGGGAAGGAGGAAGG - Intronic
968807800 4:2786838-2786860 ATGGAGAAGTGGAAGGGGGAGGG + Intergenic
968976092 4:3822778-3822800 AAGGAGGGGCGGGAGGAGAAGGG - Intergenic
969270306 4:6095077-6095099 GGGGAGTGGGGGAGGGAGGAAGG + Intronic
969510554 4:7615173-7615195 ATGGAGTGAAGGAAGGCAGATGG - Intronic
969525443 4:7701793-7701815 ATGGAGGGGCAGAGGGAAGACGG + Intronic
969551269 4:7869211-7869233 ATGGATGGAGGGAAGGAGGAAGG + Intronic
969576604 4:8039576-8039598 GTGGAGTGTGGGAAGGAAGAAGG - Intronic
970273164 4:14368493-14368515 ATGGAGAGCCAGAAGGGGGATGG + Intergenic
970304241 4:14715045-14715067 ATGGGGTGGGGGGAGGGGGAAGG + Intergenic
971033787 4:22670300-22670322 AGGGAGTGAGGGAAGCAGGAAGG - Intergenic
971393690 4:26209590-26209612 AGGGAGAGAGGGAAGGAGGAAGG - Intronic
971393698 4:26209614-26209636 AGGGAGAGAGGGAAGGAGGAAGG - Intronic
971393706 4:26209638-26209660 AGGGAGAGAGGGAAGGAGGAAGG - Intronic
971393714 4:26209662-26209684 AGGGGGAGACGGAAGGAGGAAGG - Intronic
971393723 4:26209686-26209708 AGGGAGAGAGGGAAGGAGGAAGG - Intronic
971393731 4:26209710-26209732 AGGGAGAGAGGGAAGGAGGAAGG - Intronic
971393739 4:26209734-26209756 AGGGAGAGAGGGAAGGAGGAAGG - Intronic
971393757 4:26209783-26209805 AGGGAGAGAGGGAAGGAGGAAGG - Intronic
971393775 4:26209832-26209854 AGGGAGAGAGGGAAGGAGGAAGG - Intronic
971393783 4:26209856-26209878 AGGGAGAGAGGGAAGGAGGAAGG - Intronic
971394314 4:26214494-26214516 AGGGAGGGAGGGAAGGAGGAAGG + Intronic
971394322 4:26214514-26214536 AGGGAGGGAGGGAAGGAGGAAGG + Intronic
971681863 4:29710107-29710129 AGGGAGTGAGGGAGGGAGGAAGG + Intergenic
971843169 4:31881027-31881049 AAGGAGGGAGGGAAGGAGGAGGG - Intergenic
971932374 4:33101778-33101800 ATGGAGGGAGGGAGGGAGGAAGG - Intergenic
971989452 4:33872674-33872696 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
972055552 4:34797417-34797439 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
972073550 4:35054951-35054973 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
972302285 4:37796164-37796186 ATGGTGTGGAGGAAAAAGGAAGG - Intergenic
972436294 4:39038739-39038761 ATGGTGTGGAGGGAGGAGAATGG - Intergenic
972622592 4:40762966-40762988 ATGAACTGGGGGAAGGTGGAGGG - Intronic
973019628 4:45186635-45186657 ATGGAGGGAGGGAAGGAGGTGGG - Intergenic
973326182 4:48864720-48864742 GTGGAGTGGGGGAAGGGGGAGGG - Intergenic
973542423 4:51947644-51947666 ATGGGGTGGTGGATGGGGGAGGG - Intergenic
973544353 4:51966080-51966102 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
974012512 4:56619928-56619950 ATGGAGTGGCTGTTGTAGGATGG + Intergenic
974093675 4:57339024-57339046 AAGGAGGGAGGGAAGGAGGAAGG - Intergenic
974284626 4:59847806-59847828 ATGGAGTGGGGGGAGGGGGGAGG + Intergenic
974321170 4:60352514-60352536 ATGGGGTGGGGGAAGGAAGAAGG - Intergenic
974327368 4:60431545-60431567 ATGGAGTGGATGAAAGGGGATGG - Intergenic
974470752 4:62315225-62315247 ATGGGGTGGGGGGAGGGGGAGGG + Intergenic
975298451 4:72761862-72761884 AGGGTGTGGTGGGAGGAGGACGG - Intergenic
975757006 4:77580830-77580852 AGGGAGAGGGGAAAGGAGGAGGG - Intronic
976126024 4:81834521-81834543 AGGGAGTGGGGGAGGGTGGAGGG + Intronic
976205885 4:82622913-82622935 AGGGAGGGACGGAAGGAGGGAGG - Intergenic
976546775 4:86344619-86344641 AGGGAGTGAGGGAGGGAGGAAGG + Intronic
976639591 4:87323949-87323971 CTCAAGTGGCAGAAGGAGGAAGG + Intergenic
976865079 4:89715295-89715317 ATGGGGTGGGGGATGGGGGAGGG + Intergenic
976933787 4:90603185-90603207 ATGCAGTGGCTGGAGGAGTAGGG + Intronic
976975333 4:91160038-91160060 ATGGGGTGGGGGCAGGGGGAGGG - Intronic
977140199 4:93361983-93362005 GTGGGGTGGGGGAAGGGGGAAGG - Intronic
977593324 4:98850858-98850880 AGGGAGGGACGGAGGGAGGAAGG + Intergenic
977900342 4:102415122-102415144 ATGGGGTGGGGGGAGGGGGAGGG + Intronic
977986759 4:103391378-103391400 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
978393382 4:108251216-108251238 ATGGGGTGGGGGAAGGAGGGAGG + Intergenic
978636244 4:110810574-110810596 ATGGAGTCGGGGGAGGGGGAGGG + Intergenic
979335958 4:119463140-119463162 GTGGGGTGGGGGATGGAGGAGGG - Intergenic
979522327 4:121682663-121682685 ATGGAGTGGAGAGAGGAGAAGGG - Intronic
979698541 4:123640925-123640947 AGGGAGGGGAGGAAGGAGGGAGG + Intergenic
979751712 4:124287596-124287618 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
979981846 4:127265737-127265759 ATGGGGTGGCGGGAGGGGGGAGG + Intergenic
980081033 4:128344347-128344369 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
980625949 4:135375002-135375024 ATGGGGTGGGGGAAGGGGGGAGG - Intergenic
980743056 4:136976556-136976578 ATGGGGTGGGGGAAGGGGGGAGG - Intergenic
980891360 4:138818736-138818758 GAGGAGCGGGGGAAGGAGGAAGG + Intergenic
981086549 4:140689668-140689690 AGGGAGGGGAGGAAGGAGAAAGG - Intronic
981185776 4:141801200-141801222 CTGAAATGGCGGAAGGTGGAAGG + Intergenic
981579517 4:146237802-146237824 ATGGAGTAGGGGCAGGAGAAAGG + Intergenic
981587705 4:146322361-146322383 ATGGGGTGGGGGAGGGGGGAGGG - Intronic
981936476 4:150245509-150245531 ATGGGGTAGGGGAAGGGGGAGGG - Intronic
982010630 4:151102626-151102648 ATGGAGGGTAGAAAGGAGGAGGG + Intronic
982277934 4:153656013-153656035 AAGGGGTGGCAGAGGGAGGATGG - Intergenic
982585382 4:157230590-157230612 ATGGAGGGAAGGAAGAAGGAAGG - Intronic
982690173 4:158539330-158539352 GTGGAGTGGGGGGAGGGGGAAGG + Intronic
982777106 4:159453165-159453187 TTGGAGTGAAGGAAGGAGAATGG + Intergenic
982854914 4:160369516-160369538 ATGGAGTGGGGGGAGGGGGGAGG + Intergenic
982889111 4:160824061-160824083 ATGGGGTGGGGGAGGGGGGAGGG + Intergenic
983272917 4:165584161-165584183 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
983512269 4:168621491-168621513 CTGGGGTGGTGGAAGGAGTAAGG - Intronic
983597662 4:169489261-169489283 ATAGAGGGGCGGAGGGAGGGAGG + Intronic
984541256 4:181040193-181040215 ATGGAGTGGGGGGAGGGGGGAGG - Intergenic
984679696 4:182593404-182593426 ATGGAGGGACGGAAGAAGAAAGG - Intronic
984989387 4:185364239-185364261 ATGGGGGAGCGGAAAGAGGAGGG + Exonic
985208642 4:187568425-187568447 ATGGAGGGAGGGAATGAGGAAGG - Intergenic
985255420 4:188065527-188065549 ATGGGGTGGCGGGAGGGGGGAGG - Intergenic
985477480 5:86354-86376 ATGGAGGGGGGGGAGGAGCAGGG - Intergenic
985957473 5:3276172-3276194 AGGGAGGGGAGGAAGGAGGGGGG + Intergenic
985957522 5:3276315-3276337 AGGGAGGGGAGGAAGGAGGGAGG + Intergenic
985957529 5:3276331-3276353 AGGGAGGGGAGGAAGGAGGGAGG + Intergenic
985957536 5:3276347-3276369 AGGGAGGGGAGGAAGGAGGGAGG + Intergenic
985957564 5:3276427-3276449 AGGGAGGGGAGGAAGGAGGGAGG + Intergenic
986362435 5:6993208-6993230 AAGGAGCGGGGGAGGGAGGAAGG - Intergenic
986421552 5:7589536-7589558 AAGGAGGGAGGGAAGGAGGAAGG + Intronic
986712680 5:10499367-10499389 GTGGAGAGGCGGAAGAAGGGGGG - Intergenic
987061682 5:14249388-14249410 GTGGAGTGGGGGAGGGAGGGAGG + Intronic
987156938 5:15098069-15098091 ATGGAGTGGGGGGAGGGGGGAGG - Intergenic
987176982 5:15322577-15322599 ATGGAGTGGTGGAGGGTGAATGG - Intergenic
987282592 5:16426119-16426141 ATGGGGTGGGGCAGGGAGGAAGG - Intergenic
987729672 5:21752806-21752828 AGGAAGTAGAGGAAGGAGGAAGG + Intronic
987774145 5:22342559-22342581 ATGGAGGGAGGGAGGGAGGAAGG - Intronic
988205339 5:28126516-28126538 ATGGAGAGCCAGAAGGGGGATGG - Intergenic
988224079 5:28389700-28389722 GTGGAGTCGGGGGAGGAGGACGG - Intergenic
988286714 5:29228214-29228236 AGGAAGTGGAGGCAGGAGGATGG - Intergenic
988457621 5:31400641-31400663 ATGGGGAGCAGGAAGGAGGAGGG - Exonic
989456166 5:41646873-41646895 ATGGAATGATGGGAGGAGGAAGG - Intergenic
989463706 5:41729768-41729790 ATGGGGTGGGGGAAGGGGGGAGG + Intergenic
989626976 5:43439006-43439028 GTGGAGTGGTGGGAGGGGGAGGG - Intergenic
989653961 5:43723813-43723835 ATGGGGTGGGGGCAGGGGGAAGG + Intergenic
989745490 5:44824649-44824671 GTGGGGTGGGGGAAGGGGGAAGG - Intergenic
989785181 5:45318413-45318435 GTGGGGTGGGGGAGGGAGGAAGG + Intronic
990000116 5:50882877-50882899 ATGGAGTGGCAAGAAGAGGAAGG - Intergenic
990099719 5:52166965-52166987 ATGGGGTGGGGGGAGGGGGAGGG - Intergenic
990190060 5:53249530-53249552 ATGGAGTGGGGGTGGGAGAATGG - Intergenic
990232723 5:53731532-53731554 AGGGAGTGAAGGAGGGAGGAAGG + Intergenic
990352642 5:54934275-54934297 ATGGGGTGGCAGCAGGGGGAAGG + Intergenic
990398046 5:55404749-55404771 ATGGAGAGAGGTAAGGAGGAAGG - Intronic
990690248 5:58355747-58355769 AGGGTGAGGGGGAAGGAGGAAGG - Intergenic
990808273 5:59691569-59691591 ATGGAGTGGGGGGAGGGGGGAGG + Intronic
991424869 5:66480339-66480361 ATGGGGTGGGGGATGGGGGAGGG - Intergenic
992183523 5:74221840-74221862 ATGGGGTGGGGGGAGGGGGAGGG - Intergenic
992321704 5:75619785-75619807 AAGGAGTGAAGAAAGGAGGAAGG - Intronic
992357298 5:75999348-75999370 AAGGAGTGGGGGAGGGAGGGAGG + Intergenic
992411695 5:76511360-76511382 AAGGAGTGGGGGAAGAAGAAGGG + Intronic
992756181 5:79908289-79908311 ATGGGGTGGAGGAAGGGGGAAGG + Intergenic
992803356 5:80313334-80313356 ATGGGGTGGGGGAAGGGGGGAGG - Intergenic
992904619 5:81334108-81334130 ATGGGGAGCCAGAAGGAGGATGG - Intronic
993191884 5:84694231-84694253 GTGGAGTGGGGGAAGCGGGAGGG - Intergenic
993858701 5:93107450-93107472 CTGGGGTGGGGGCAGGAGGATGG - Intergenic
994066228 5:95545682-95545704 GTGGGGTTGCTGAAGGAGGAAGG - Intronic
994198855 5:96949911-96949933 AGGGAGGGAGGGAAGGAGGACGG - Intronic
994240600 5:97415986-97416008 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
994385339 5:99124782-99124804 GTGGGGTGGCGGGAGGGGGAAGG - Intergenic
994417339 5:99489137-99489159 ATGGAGGGCAGGAAGGAGAAGGG - Intergenic
994462623 5:100086029-100086051 ATGGAGGGCAGGAAGGAGAAGGG + Intergenic
994731026 5:103490620-103490642 AGGGAGGGAGGGAAGGAGGAGGG - Intergenic
995121131 5:108536202-108536224 ATGGAGAGCTGGAAAGAGGATGG - Intergenic
995324495 5:110875198-110875220 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
995324531 5:110875370-110875392 AAGGAGGGAGGGAAGGAGGAAGG - Intergenic
995582452 5:113616201-113616223 GTGGGGTGGGGGAAGGAGGGAGG - Intergenic
995931415 5:117450800-117450822 AAGGAGGGAGGGAAGGAGGAAGG - Intergenic
995996318 5:118304811-118304833 AAGGAGAGATGGAAGGAGGAAGG + Intergenic
996012450 5:118495882-118495904 GTGGGGTGGGGGAAGGGGGAAGG + Intergenic
996256273 5:121408039-121408061 GTGGGGTGGGGGAAGGGGGAAGG - Intergenic
996547363 5:124694712-124694734 ATGGGGTGGGGGAGGGGGGAGGG - Intronic
996847908 5:127921038-127921060 AAGGAAAGGAGGAAGGAGGAAGG + Intergenic
996853353 5:127977623-127977645 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
997529272 5:134572091-134572113 AGGGTGTGGGGGAAGGAGGCTGG + Intronic
997763320 5:136472384-136472406 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
997854208 5:137358522-137358544 GAGGAGTGGGGGAAGGAAGAGGG + Intronic
997876265 5:137550371-137550393 GTGGGGTGGGGGAAGGAGGAGGG + Intronic
998103613 5:139454732-139454754 ATGGAGTGGCAGATGCAGGCTGG + Intronic
998141379 5:139701453-139701475 AGGAAGGGGCGGAAGGGGGAGGG - Intergenic
998445751 5:142197169-142197191 ATGGTGTGGCGGGGGGAGGGTGG - Intergenic
999139461 5:149348542-149348564 AAGGAGTGGAGGAGGGATGAGGG - Intronic
1000147573 5:158468296-158468318 AAGGAGGGAGGGAAGGAGGAAGG - Intergenic
1000327601 5:160184205-160184227 ATGGAGGGAGGGAAGGAGGGAGG - Intergenic
1000614683 5:163413933-163413955 AAGGAGGGAGGGAAGGAGGAAGG + Intergenic
1000976816 5:167774183-167774205 AGGGAGGGAGGGAAGGAGGAAGG + Intronic
1000984867 5:167855768-167855790 AGGGAATGAGGGAAGGAGGAAGG + Intronic
1001408736 5:171495379-171495401 AGGGAGAGCGGGAAGGAGGAAGG + Intergenic
1001647020 5:173289728-173289750 AGGGAGAGAGGGAAGGAGGAAGG - Intergenic
1001887227 5:175303958-175303980 AATGAGTAGCGGAAGGAGGAAGG - Intergenic
1002134239 5:177098158-177098180 ATGGAGTGGGGTGAGGTGGAGGG + Intergenic
1002553420 5:180015540-180015562 AAGGAGTAGGGGAAGGAGTAGGG + Intronic
1002566743 5:180116437-180116459 AGGGAGGGAAGGAAGGAGGAAGG - Intronic
1002762648 6:214046-214068 ATGGGGAGCTGGAAGGAGGAGGG - Intergenic
1002773239 6:307262-307284 AGGGAGGGGAGGAAGGAGAAGGG - Intronic
1002886950 6:1305798-1305820 ATAGGGTGGAGGAAGGAGCAAGG + Intergenic
1003230896 6:4252819-4252841 GTGGGGTGGGGGAAGGGGGAAGG + Intergenic
1003465954 6:6380210-6380232 AGGGAGAGGAGGAGGGAGGAAGG - Intergenic
1003470847 6:6430066-6430088 ATGGGGTGGGGGGAGGGGGAGGG + Intergenic
1003493132 6:6641396-6641418 AGGGACTGGAGGAAGCAGGAGGG - Intronic
1003649226 6:7943325-7943347 GTGGGGTGGGGGAAGGGGGAGGG - Intronic
1003837128 6:10083857-10083879 AGGGAGAGACGGAGGGAGGAAGG + Intronic
1004131177 6:12921538-12921560 AGGGAAAGGAGGAAGGAGGAAGG + Intronic
1004549995 6:16637345-16637367 ATGGAGTGGGGGGAGGGGGGAGG + Intronic
1005081912 6:21965276-21965298 GAGGAGGGGAGGAAGGAGGAGGG - Intergenic
1005081918 6:21965291-21965313 GAGGAGGGGAGGAAGGAGGAGGG - Intergenic
1005763173 6:28986337-28986359 ATGGGGTGGGGGTAGGAGGTTGG - Intergenic
1005844270 6:29765490-29765512 ATGGAGTGTCTGAGGGAGGAGGG - Intergenic
1005856375 6:29866282-29866304 ATGGAGTGTCTGAGGGAGGAGGG - Intergenic
1006025747 6:31145577-31145599 AAGGACTGGTGAAAGGAGGAAGG + Intronic
1006137297 6:31902709-31902731 ATGGAGTGGAGGAAAGTTGAGGG - Intronic
1006174316 6:32112741-32112763 AGGGAGTGGGGGAAGGAAGGAGG + Intronic
1006443671 6:34067353-34067375 AGGGAGCGAAGGAAGGAGGAAGG - Intronic
1007038278 6:38698337-38698359 ATGGAAAGGAGGAAGGAAGAAGG - Intronic
1007130303 6:39466233-39466255 AAGGAGAGAAGGAAGGAGGAAGG - Intronic
1007155836 6:39742404-39742426 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1007496057 6:42260948-42260970 AGAGAGTGGGGAAAGGAGGAGGG + Intronic
1007696771 6:43739033-43739055 GTGGAGTGGGGGTGGGAGGATGG - Intergenic
1008023196 6:46603512-46603534 AGGCAGTGGGGGAAAGAGGAAGG - Intronic
1008269786 6:49477419-49477441 ATGGGGTGGGGGGAGGGGGAGGG + Intronic
1008558825 6:52703440-52703462 AGGGAGGGAAGGAAGGAGGAAGG - Intergenic
1008724641 6:54402025-54402047 ATGGGGTGGGGGGAGGGGGAGGG - Intergenic
1008744406 6:54651800-54651822 GTGGGGTGGCGGGAGGGGGAGGG + Intergenic
1008794926 6:55291501-55291523 ATGGGGTGGGGGTAGGAGGGAGG + Intergenic
1008874965 6:56315650-56315672 AGGGAGAGGAGGAAGGAAGAGGG - Intronic
1008916795 6:56796777-56796799 AGGGAGAGAAGGAAGGAGGAAGG + Intronic
1008950811 6:57156804-57156826 ATGGATTGGGGGCAGGAGGTGGG + Intronic
1009445628 6:63739063-63739085 AAGGAGGGGAGGAAGGAGGGAGG - Intronic
1009804024 6:68578838-68578860 AGGGAGGGACGGAGGGAGGAAGG + Intergenic
1010028374 6:71245743-71245765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
1010168179 6:72941566-72941588 AGGGAGGGAGGGAAGGAGGAAGG - Intronic
1010274194 6:73949953-73949975 AGGGAATGGGGGAAAGAGGAAGG + Intergenic
1010312802 6:74407140-74407162 ATGGGGTGGGGGGAGGAGGGAGG + Intergenic
1010482227 6:76369572-76369594 ATGGGGTGGGGGGAGGGGGAAGG - Intergenic
1010643603 6:78360201-78360223 ATGGGGTGGGGGAGGGGGGAGGG + Intergenic
1010681287 6:78802312-78802334 GTGGGGTGGGGGAAGGAGGGAGG - Intergenic
1010943966 6:81953179-81953201 GTGGAGTGGGGGGAGGGGGAAGG - Intergenic
1011269600 6:85563913-85563935 ATGGGGTGGGGGAAGGGGGGAGG - Intronic
1011445248 6:87432457-87432479 ATGGAGAGGGGGAGGCAGGAGGG - Intronic
1011525472 6:88259608-88259630 ATGGGGTGGGGGGAGGCGGAAGG + Intergenic
1011567645 6:88694844-88694866 ATGCTGTGGTGGAAGGTGGAAGG - Intronic
1011865899 6:91826561-91826583 GTTGAGTAGAGGAAGGAGGAAGG - Intergenic
1012055068 6:94395752-94395774 AAGGAGAGGAGGAAGGAGGAGGG + Intergenic
1012123693 6:95399501-95399523 GTGGAGTGGGGGAAGGGGGGAGG + Intergenic
1012188636 6:96253323-96253345 ATGGGGTGGGGGGAGGGGGAAGG + Intergenic
1012489390 6:99764188-99764210 CTGGGGTGGCGGGAGGGGGAAGG - Intergenic
1012587078 6:100936539-100936561 ATTGGGAGGTGGAAGGAGGAAGG + Intergenic
1013123276 6:107159314-107159336 AGGGAGGGAGGGAAGGAGGAAGG + Intronic
1013342839 6:109232105-109232127 GAGGAGTGGCAGAAGGAAGAGGG - Intergenic
1013415089 6:109917725-109917747 AGGGAGTGGTGGAAGGAGAGGGG - Intergenic
1013424443 6:109998262-109998284 AGGGAGGGAGGGAAGGAGGAAGG + Intergenic
1013587614 6:111593660-111593682 AGGGAGAGACGGAGGGAGGAGGG - Intronic
1013766284 6:113577995-113578017 AAGGAGTGAGGGAAGGAGGGAGG - Intergenic
1013839771 6:114377617-114377639 AGGAAGTGGAGGCAGGAGGATGG - Intergenic
1013851697 6:114523710-114523732 ATGGAATGGGAGAAGGTGGAAGG + Intergenic
1013924098 6:115447191-115447213 GTGGGGTGGGGGGAGGAGGAAGG + Intergenic
1014964532 6:127730513-127730535 AGGGAGGGAGGGAAGGAGGAAGG + Intronic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015447021 6:133317944-133317966 ATGGATCAACGGAAGGAGGATGG - Intronic
1015874488 6:137809052-137809074 ATGGGGTGGGGGCAGGAGGGAGG + Intergenic
1015942930 6:138469961-138469983 AGGGAGTGGGGGAGGCAGGAAGG + Intronic
1016547353 6:145239100-145239122 AAGGAGGGAAGGAAGGAGGAAGG - Intergenic
1017229154 6:152053401-152053423 AGGGAGAGACAGAAGGAGGAAGG - Intronic
1017251562 6:152285570-152285592 CTGGAGTGGCTGAAGAAGGCTGG - Intronic
1017572900 6:155766529-155766551 AGGGAGAGACCGAAGGAGGAAGG - Intergenic
1017988701 6:159467509-159467531 GGGGAGGGGAGGAAGGAGGAAGG + Intergenic
1018001889 6:159586776-159586798 ATGGAGGGTGGGAAGGAGGGTGG + Intergenic
1018001899 6:159586805-159586827 ATGGAGGGTGGGAAGGAGGGTGG + Intergenic
1018106082 6:160487727-160487749 ATGGATTGGCCAAAGGTGGAAGG - Intergenic
1018816797 6:167338939-167338961 AGGGAGAGCAGGAAGGAGGAAGG - Intronic
1018924285 6:168195531-168195553 ATGGAGCAGGGGGAGGAGGAGGG - Intergenic
1019229209 6:170544007-170544029 ATGAAGTGGCCTAAGGAAGATGG + Intronic
1019273944 7:166192-166214 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
1019315533 7:382563-382585 AGGGAGGGAGGGAAGGAGGAGGG + Intergenic
1019362707 7:613765-613787 CCGGAGCGGCGGGAGGAGGAAGG - Intronic
1019471868 7:1225343-1225365 CTGGAGTGGCGGCAGAAGGAGGG + Intergenic
1019538624 7:1541459-1541481 GTGGAGTGGTGGGAGGAGGCGGG + Exonic
1019568698 7:1697679-1697701 ATAAAGTCCCGGAAGGAGGAGGG - Intronic
1019608164 7:1920524-1920546 ATGGAGTTGGGGGAGAAGGAGGG + Intronic
1019721261 7:2573122-2573144 AGGGACTCACGGAAGGAGGAGGG - Intronic
1019730609 7:2627486-2627508 ATGGAGGGAAGGAAGGTGGAAGG + Intergenic
1019947688 7:4343052-4343074 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
1019949482 7:4359735-4359757 ATGGGGTGGAGGGAGGGGGAAGG + Intergenic
1020123422 7:5518669-5518691 AGGGAGTGGGGGGAGGAGAAGGG - Intergenic
1020454602 7:8357489-8357511 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
1020520937 7:9186295-9186317 ATGGGGTGGGAGAAGGAGGGAGG - Intergenic
1020640969 7:10753064-10753086 ATGGGGTGGGGGAAGTGGGAAGG + Intergenic
1020917531 7:14214929-14214951 ATGGAGTGGGAGAAGGAGGGAGG - Intronic
1021056451 7:16053297-16053319 GTGGAGGGGCGGGATGAGGATGG - Intergenic
1021170258 7:17390958-17390980 TTGCAGTGGGGAAAGGAGGAGGG - Intergenic
1021303852 7:19006725-19006747 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1021417375 7:20403761-20403783 AGGGAGGGAAGGAAGGAGGAAGG + Intronic
1021560501 7:21964749-21964771 ATGGAGAGCTGGAAGGGGGATGG - Intergenic
1021777970 7:24072476-24072498 ATGGGCTGGGGGAAGGAGGCTGG + Intergenic
1022096161 7:27142878-27142900 AAGAAGAGGAGGAAGGAGGAAGG + Intronic
1022099669 7:27161619-27161641 GTGGAGTGGGGGAAGGGGGTCGG + Intergenic
1022134250 7:27432341-27432363 AGGGAGAGGCGGAAGGCTGAAGG - Intergenic
1022218189 7:28286108-28286130 AGAGAGTGGAGGAAGGAAGAAGG + Intergenic
1022282462 7:28924980-28925002 AGGGAGGGGAGGAAGAAGGAAGG + Intergenic
1022574805 7:31487306-31487328 AAGGACAGGAGGAAGGAGGAAGG - Intergenic
1023834976 7:44062627-44062649 ATGGAGTGGGGGAGGGTGGGTGG + Intronic
1024350734 7:48360181-48360203 ATGGGGTGGGGGAGGGGGGAGGG - Intronic
1024482966 7:49884166-49884188 ATGGAGTGTGGGAGGGAAGAAGG + Intronic
1024507014 7:50170379-50170401 AAGGAGGGAGGGAAGGAGGAAGG + Intergenic
1024766260 7:52664475-52664497 CTGGAGTGGCTGGAGCAGGAGGG - Intergenic
1024819452 7:53310451-53310473 AGGGAGTGGTGAAAGGAGGGAGG + Intergenic
1024822377 7:53347910-53347932 ATGGGGTGGGGGAAGTGGGAGGG + Intergenic
1025147048 7:56514192-56514214 AAGGAGTGAGGGAAGGAGGGAGG - Intergenic
1025147080 7:56514285-56514307 AAGGAGTGAGGGAAGGAGGGAGG - Intergenic
1025234656 7:57226541-57226563 CAGGAGTGGAGCAAGGAGGATGG + Intergenic
1025238874 7:57255121-57255143 GTGGGGTGGCGGAAGGGGGGAGG + Intergenic
1025913422 7:65846436-65846458 TAGGAATGGAGGAAGGAGGAAGG - Intergenic
1026191913 7:68136509-68136531 AGGGAGGAGGGGAAGGAGGAGGG + Intergenic
1026191921 7:68136528-68136550 AGGGAGGAGGGGAAGGAGGAGGG + Intergenic
1026253951 7:68694627-68694649 ATGGATTGGCTGCAGGAGGTTGG - Intergenic
1026517818 7:71087876-71087898 AAGGAGTGGCAGGAGGAGGCGGG + Intergenic
1026680224 7:72461027-72461049 ATGGAGAGAAGGAAGGAGGAAGG - Intergenic
1026917778 7:74132524-74132546 AGGGAGGGCGGGAAGGAGGAAGG - Intergenic
1027336312 7:77154447-77154469 ATGGGGTGGGGGAGGGGGGAGGG - Intronic
1027464935 7:78503593-78503615 AAGGAGGGGGAGAAGGAGGAGGG - Intronic
1027564948 7:79780072-79780094 GTGGAGTAGGGGAAGGGGGAAGG - Intergenic
1027565655 7:79789987-79790009 AGGGAGGGACGGAAGGAGGGAGG + Intergenic
1028050605 7:86179951-86179973 ATGGGGTGGGGGGAGGAGGGAGG + Intergenic
1028373053 7:90116238-90116260 ATGGGGTGGGGGAAGGGGGGAGG + Intergenic
1029004884 7:97198871-97198893 ATGCATTGGGAGAAGGAGGAGGG - Intergenic
1029249192 7:99223821-99223843 AGGGAGCGGGGGAGGGAGGAAGG + Intergenic
1029337769 7:99916929-99916951 ATGGAGCATGGGAAGGAGGATGG - Intronic
1029356077 7:100052749-100052771 AGTGAGTGCAGGAAGGAGGAAGG + Intronic
1029578307 7:101418845-101418867 GTGGAGAGGAGGAAAGAGGAAGG - Intronic
1029584862 7:101463825-101463847 AGGGAGGGAAGGAAGGAGGAAGG - Intronic
1029779476 7:102716654-102716676 ATGGGGTGGGGGAGGGGGGAGGG + Intergenic
1029873455 7:103721210-103721232 AAGGAAGGGTGGAAGGAGGAAGG - Intronic
1030035320 7:105403846-105403868 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
1030070529 7:105693976-105693998 CTGGGGTGGGGAAAGGAGGAGGG + Intronic
1030072196 7:105707444-105707466 AATGAGTGGGGGATGGAGGAAGG + Intronic
1030433988 7:109491414-109491436 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1030961655 7:115930525-115930547 ATGGAGTGGGGGGAGGAGGGAGG + Intergenic
1031246209 7:119316239-119316261 ATGGAGTGGGGGAGGGGGGAGGG - Intergenic
1031327404 7:120418786-120418808 ATGGAGTGGGGTACGGATGAGGG - Intronic
1031464407 7:122090930-122090952 AGGGGTTGGGGGAAGGAGGATGG - Intronic
1031527626 7:122840278-122840300 GTGGGGTGGGGGGAGGAGGAAGG + Intronic
1032252728 7:130271895-130271917 ATGGAGTAGCAGATGCAGGAAGG - Intronic
1032510929 7:132471713-132471735 TTGGAGTGGGAGGAGGAGGAGGG + Intronic
1032685661 7:134231535-134231557 AGGGAGGGACGGAGGGAGGAAGG - Intronic
1032685738 7:134231767-134231789 AGGGAGGGACGGACGGAGGAAGG - Intronic
1032768188 7:135020908-135020930 GTGGAGTGGGGGAGGGGGGAGGG + Intronic
1032772425 7:135072763-135072785 GTGGAGTGGGGGAGGGGGGAGGG + Intronic
1032934293 7:136711230-136711252 AAGGAGTGGGAGGAGGAGGAGGG + Intergenic
1032978342 7:137251685-137251707 AAGGAGGTGGGGAAGGAGGAAGG - Intronic
1033062127 7:138119252-138119274 AAGGAGTGACGGAGGGAGGAAGG + Intergenic
1033263675 7:139865872-139865894 AGGGAGGGAGGGAAGGAGGAAGG + Intronic
1033305715 7:140223927-140223949 ACGGAGTGGCTGAGGGTGGAAGG - Intergenic
1033344052 7:140513493-140513515 ATGGTGTGGAGGCAGGAGAATGG + Intergenic
1033604214 7:142913894-142913916 AGGGAGGGGCAGAAAGAGGAAGG - Intronic
1034026733 7:147712743-147712765 ATGGGGTGGTGGGAGGAGGGAGG + Intronic
1034055782 7:148033465-148033487 GTGGAGTGGCGGGTAGAGGAAGG - Intronic
1034064590 7:148124103-148124125 AGGGACTGGCTGAAGGAGCAAGG + Intronic
1034499428 7:151440205-151440227 CTGGAGTGGTGGGGGGAGGAGGG + Intronic
1034718747 7:153267751-153267773 ATGGGGTTGTGGAAGGAGTATGG + Intergenic
1035238066 7:157512914-157512936 GTGGGGTGGGAGAAGGAGGAGGG + Intergenic
1035673069 8:1434847-1434869 AGGGAGGGGAGGAAGGATGAAGG - Intergenic
1036636803 8:10556532-10556554 ATGCAGTGGAGGAAGCAGGCAGG + Intergenic
1036661929 8:10714556-10714578 ATGGAGGGGCGGGTGAAGGAAGG - Intergenic
1036744064 8:11391512-11391534 AAGGAGTTCCAGAAGGAGGACGG - Intronic
1037098061 8:15008806-15008828 AGGGAGGGACGGAGGGAGGAAGG + Intronic
1037127949 8:15372883-15372905 ATAGAGTGGATGATGGAGGAGGG - Intergenic
1037166829 8:15840226-15840248 GTGGGGTGGGGGAAGGAGGGAGG + Intergenic
1037313724 8:17581664-17581686 ATGGTGCGGTGGGAGGAGGAGGG - Intronic
1037355922 8:18019380-18019402 ATGGACTGGGGTAAGGGGGATGG + Intronic
1037540430 8:19865450-19865472 AGGGAGAGAGGGAAGGAGGAAGG + Intergenic
1037674706 8:21043276-21043298 GTGGGGTGGTGGAAGGTGGAGGG - Intergenic
1037796275 8:21997843-21997865 GTGGGGGGGAGGAAGGAGGAAGG + Intronic
1037811568 8:22089677-22089699 GTGGAGCGGAGGAAGGAGGCAGG - Intronic
1038022855 8:23564482-23564504 AGGGAGTCGGGGAGGGAGGAAGG + Intronic
1038087691 8:24218029-24218051 GTGGAGAGATGGAAGGAGGAAGG + Intergenic
1038870076 8:31484262-31484284 ATGGGGTGGGGGAGGGGGGAGGG - Intergenic
1038896888 8:31793882-31793904 ATGGAGAGATGGAAGGAGGAAGG - Intronic
1038930543 8:32188810-32188832 GTGGGGTGGGGGGAGGAGGAGGG + Intronic
1038954829 8:32456480-32456502 ATGGAGTAGGGTATGGAGGAGGG - Intronic
1039428577 8:37506780-37506802 AGGGAGAGAGGGAAGGAGGAAGG + Intergenic
1040564274 8:48552149-48552171 AAGGAGGAGCGAAAGGAGGAGGG - Intergenic
1040607997 8:48954044-48954066 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
1041000602 8:53446669-53446691 ATGGAGTAGGGGGAGGGGGAGGG + Intergenic
1041035033 8:53780682-53780704 GTGGAGTGGGGGATGGGGGAGGG - Intronic
1041202736 8:55466484-55466506 ATGGAGTGGGGGGAGGGGGAAGG + Intronic
1041226757 8:55707965-55707987 GTGGAGTGGGGGTAGGGGGAAGG - Intronic
1041628174 8:60055012-60055034 AAGGAGGGAGGGAAGGAGGAAGG + Intergenic
1041759452 8:61348330-61348352 ATGGAGTGGGGGGAGGGGGGAGG + Intronic
1041893275 8:62895776-62895798 AGGGAGTGGGGATAGGAGGAAGG - Intronic
1042155122 8:65836896-65836918 AGGGGGAGGAGGAAGGAGGATGG - Intronic
1042349054 8:67757710-67757732 GTGGGGTGGGGGAAGGAGGGAGG + Intergenic
1042555816 8:70033116-70033138 AGGGAGAGGAGAAAGGAGGAAGG + Intergenic
1042602191 8:70509973-70509995 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
1042864469 8:73345191-73345213 ATGGAGTGGGAGATGGAGGGCGG - Intergenic
1043316495 8:78928431-78928453 ATGGGGTGGGGGAGGGGGGAGGG + Intergenic
1043333250 8:79142832-79142854 GTGGGGTGGGGGAAGGGGGAAGG - Intergenic
1043410716 8:79991119-79991141 ATTGAGTGGATGCAGGAGGAAGG + Intronic
1043986400 8:86697783-86697805 ATGGGGTGGGGGGAGGAGGGAGG - Intronic
1044007374 8:86954975-86954997 ATGGAGTGGGGGGAGGGGGGAGG - Intronic
1044096893 8:88078047-88078069 AGGGAGAGAGGGAAGGAGGAAGG - Intronic
1044115541 8:88328841-88328863 ATGGTTTGGCTGAAAGAGGAAGG + Intergenic
1045316648 8:101049243-101049265 AAGGAGGGGGGGAGGGAGGATGG - Intergenic
1045412029 8:101929396-101929418 ATGGAGGGAGGGAGGGAGGAAGG + Intronic
1045491294 8:102671316-102671338 AGGGAGTGGAGGAGGGTGGAGGG - Intergenic
1046011825 8:108557753-108557775 AGGGAGTAAGGGAAGGAGGAAGG - Intergenic
1046206173 8:111000695-111000717 GTGGGGTGGAGGAAGGGGGAGGG - Intergenic
1046537231 8:115530929-115530951 ATGGGGTGGGGGAAGGGGGGAGG + Intronic
1046565479 8:115893845-115893867 ATGGGGTGGGGGGAGGGGGAGGG + Intergenic
1046673909 8:117088035-117088057 ATGGAGAGAGGGAAGGAGAAAGG + Intronic
1046848159 8:118942210-118942232 ATGGGGTGGGGGGAGGGGGAAGG - Intronic
1047061837 8:121235728-121235750 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
1047109004 8:121767733-121767755 ATTGAGTGGAGGAAAAAGGAAGG - Intergenic
1047154337 8:122299907-122299929 GTGGAGTGGCGGGAGGGGGGAGG + Intergenic
1047293657 8:123551936-123551958 ATGGGGTGGGGGAAGGGGGGAGG + Intergenic
1047481233 8:125285410-125285432 AGGGAGGGGAGGAGGGAGGAAGG - Intronic
1047767036 8:127998614-127998636 AGGGAGTGAGGGAGGGAGGAAGG - Intergenic
1047927643 8:129697012-129697034 AGGGAGGGAAGGAAGGAGGAAGG + Intergenic
1048363159 8:133715348-133715370 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
1048736992 8:137513050-137513072 AAGGAGGGAAGGAAGGAGGAAGG - Intergenic
1048805786 8:138239998-138240020 ATGGGGTGGGGGAGGGGGGAGGG + Intronic
1049328728 8:142038543-142038565 ATGGACTGGAGGAAGGAGTCAGG - Intergenic
1049350770 8:142163401-142163423 ATGGATTGACGGATGGAGGATGG + Intergenic
1049406229 8:142452867-142452889 CCGCAGTGGCGGAAGGCGGAGGG + Intronic
1049937596 9:514247-514269 AGGGAGGGACGGAGGGAGGAAGG - Intronic
1050008868 9:1164299-1164321 ATGGAGGGAGGGAAGGAGGAAGG - Intergenic
1050156923 9:2677414-2677436 ATGGAGTGGGGGTAGAAGAATGG - Intergenic
1050330092 9:4537042-4537064 GTGGAGTGGGGGGAGGAGGGAGG + Intronic
1050368097 9:4891195-4891217 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
1050497324 9:6258169-6258191 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
1051114850 9:13683035-13683057 ATGGAGTGGTGGAACCAGGCAGG + Intergenic
1051134356 9:13901468-13901490 ATTGACTCACGGAAGGAGGAAGG + Intergenic
1051697216 9:19781368-19781390 ATGAAGTAGGGGAAGGTGGAAGG + Intronic
1052638726 9:31136321-31136343 AGGGAGGGAGGGAAGGAGGAAGG + Intergenic
1053073821 9:35116226-35116248 GAGAAGGGGCGGAAGGAGGAGGG - Intronic
1053330892 9:37206287-37206309 AGGGAGAGGGGGAAGGGGGAAGG - Intronic
1053908958 9:42876026-42876048 GTGGGGTGGAGGAAGGGGGAAGG - Intergenic
1054817707 9:69491454-69491476 ATGGGGTGGGGGGAGGTGGAGGG + Intronic
1054981257 9:71209385-71209407 AGGGAGAGGGGGAAGGAGGGAGG + Intronic
1055087478 9:72328937-72328959 ATGGGGTGGGGGGAGGGGGAGGG - Intergenic
1055193245 9:73553260-73553282 ATGGATGGAAGGAAGGAGGAAGG - Intergenic
1055720789 9:79171881-79171903 GTGGAGTGGAGGGAGGAGGATGG + Intergenic
1055819321 9:80242814-80242836 ATGGAGAGAAGGAAGGAGGTAGG - Intergenic
1056253210 9:84771971-84771993 ATAGAGTAGCAGAAGGAGCAGGG + Intronic
1056327355 9:85490915-85490937 ATGGGGAGCCAGAAGGAGGATGG - Intergenic
1056381772 9:86062686-86062708 AGGGAGGGGAGGCAGGAGGAAGG + Intronic
1056523155 9:87418746-87418768 AGGGAGGGAAGGAAGGAGGAAGG - Intergenic
1056666179 9:88582623-88582645 AGGGAGGGGAGGAGGGAGGAAGG - Intronic
1056851355 9:90087176-90087198 AGGGAGAGATGGAAGGAGGAAGG + Intergenic
1056869735 9:90266330-90266352 ATGGAGGGAGGGGAGGAGGAGGG - Intergenic
1056978641 9:91285309-91285331 ATGGGGTGGGGGAAGGGGGGAGG + Intronic
1056999286 9:91492750-91492772 ATGGAGTAGCTGAAAGATGAAGG + Intergenic
1057077642 9:92147287-92147309 AGGGAGAGAAGGAAGGAGGAAGG - Intergenic
1058235816 9:102487842-102487864 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1058416991 9:104799772-104799794 ATGGAGTGGGGCAAGGGAGAGGG - Intronic
1058669270 9:107346920-107346942 AGGGAAGGGAGGAAGGAGGAAGG + Intergenic
1058960478 9:109988625-109988647 AGGGAGGGAGGGAAGGAGGAAGG + Intronic
1058960496 9:109988682-109988704 AAGGAAGGGCGGGAGGAGGAAGG + Intronic
1059762759 9:117354688-117354710 CTGGAGGGAGGGAAGGAGGAGGG - Intronic
1059880831 9:118687104-118687126 ATGGAGTGGCTGAAGCAGGATGG - Intergenic
1060281307 9:122217338-122217360 ATTGGGTGGTGGAAGGAGGAAGG - Intronic
1060728323 9:126020992-126021014 CTGGAGTGGAGGCAGCAGGAAGG - Intergenic
1061257317 9:129460347-129460369 ATGGAGAGGAGGAGGGAGGGAGG - Intergenic
1061326446 9:129867580-129867602 GGGGGGTGGCGGAAGGATGAGGG - Intronic
1061416542 9:130450364-130450386 ATGGAGGGAAGGAGGGAGGAAGG - Intronic
1061726511 9:132584854-132584876 ATGGAGAAGGGGGAGGAGGAAGG + Intronic
1061853550 9:133429442-133429464 ATGGAGGGGTGGATGGAGGAGGG - Intronic
1061946277 9:133909937-133909959 ATGCAGGGGAGGATGGAGGATGG - Intronic
1061963178 9:133998493-133998515 ATGGATTGGTGGAAGGATGGAGG - Intergenic
1061963204 9:133998581-133998603 ATGGATTGGTGGAAGGATGGAGG - Intergenic
1061963230 9:133998669-133998691 ATGGATTGGTGGAAGGATGGAGG - Intergenic
1061963256 9:133998757-133998779 ATGGATTGGTGGAAGGATGGAGG - Intergenic
1061963282 9:133998845-133998867 ATGGATTGGTGGAAGGATGGAGG - Intergenic
1062050506 9:134444402-134444424 AAGGAGGAGGGGAAGGAGGAGGG - Intergenic
1062468754 9:136692863-136692885 AATGAGTGACGGAAGGAGGGAGG + Intergenic
1062469747 9:136697088-136697110 AGGGGGAGGGGGAAGGAGGAGGG - Intergenic
1062703957 9:137924336-137924358 AAGGAGGGAGGGAAGGAGGAAGG - Intronic
1062703970 9:137924372-137924394 AGGGAGGGAAGGAAGGAGGAGGG - Intronic
1185535113 X:854916-854938 AGGGAATGGAGAAAGGAGGAAGG - Intergenic
1185591993 X:1283359-1283381 AGGGAGGGACGGAAGAAGGAAGG - Intronic
1185627589 X:1493386-1493408 AGGGAGGGAGGGAAGGAGGAAGG + Intronic
1185640816 X:1588485-1588507 AGGGAGTGGAGGAAAGGGGAGGG - Intergenic
1185640998 X:1588868-1588890 AGGGAGTGGAGGAAAGGGGAGGG - Intergenic
1185680083 X:1881295-1881317 AGGGAGGGAGGGAAGGAGGAAGG + Intergenic
1185766903 X:2732922-2732944 AAGGAGAGAGGGAAGGAGGAAGG - Intronic
1186020616 X:5251221-5251243 AGGGAGTGAGGGAAGAAGGAAGG + Intergenic
1186632263 X:11362504-11362526 GTGGGGTGGCGGAAGGGGGGAGG + Intronic
1186647254 X:11520303-11520325 GTGGGGTGGGGGAAGGGGGAGGG - Intronic
1186974164 X:14882011-14882033 ATGGGGTGGGGGAAGGGGGGAGG + Intronic
1187029369 X:15469925-15469947 AGTGAGTGGCAGAAGGAGTATGG + Intronic
1187068008 X:15859940-15859962 ATGGGGTGGGGGGAGGGGGAGGG - Intergenic
1187258799 X:17666284-17666306 ATGGATTGGTGAAAGGAGAAGGG + Intronic
1187333246 X:18359914-18359936 AGGGACTGGCGGAAGCTGGAAGG - Intergenic
1187665460 X:21604315-21604337 GTGGAGTGGGGGGAGGGGGAAGG + Intronic
1187769883 X:22683146-22683168 GTGGGGTGGGGGAAGGGGGAAGG + Intergenic
1188618868 X:32194586-32194608 AGGTAGTGAGGGAAGGAGGAGGG + Intronic
1188702031 X:33277114-33277136 ATGGATTGGGGGAAGGTGGCAGG - Intronic
1189772456 X:44439904-44439926 AGGGAGGGGCGGAGGGAGGGAGG + Intergenic
1190522759 X:51297015-51297037 ATGGGGTGGGGGGAGGAGGGGGG + Intergenic
1190551538 X:51587127-51587149 GTGGAGTGGGGGAAGGGGGGAGG - Intergenic
1190624428 X:52322913-52322935 GTGGAGTGGGGGAAGGGGGGAGG + Intergenic
1190627610 X:52351986-52352008 AAAGAGAGGAGGAAGGAGGAAGG - Intergenic
1190644261 X:52510255-52510277 ATGGAGAGGGGGAGGAAGGAAGG - Intergenic
1191085871 X:56565906-56565928 AGGGAGTGAGGGAAGTAGGAGGG - Exonic
1191777097 X:64826511-64826533 AGGGACTGGGGGAAAGAGGAAGG + Intergenic
1191782552 X:64884523-64884545 ATGGGGTGGGGGAAGGAGGGAGG + Intergenic
1191844723 X:65538398-65538420 AGGGGGTGGGGGAGGGAGGAGGG + Intergenic
1191932373 X:66388305-66388327 GTGGGGTGGGGGAAGGGGGAAGG - Intergenic
1191956204 X:66644974-66644996 GTGGGGTGGGGGAAGGAGGGAGG - Intergenic
1192098515 X:68239071-68239093 ATGGGGAGCCAGAAGGAGGATGG + Intronic
1192112315 X:68377572-68377594 GTGGGGTGGGGGGAGGAGGAGGG - Intronic
1192219568 X:69188219-69188241 ATGGAGGGAGGGAAGGAGGGAGG - Intergenic
1192253450 X:69433865-69433887 ATGGGGTGGGGGCAGGGGGAGGG - Intergenic
1192287130 X:69750164-69750186 ATGGGGTGGGGGGAGGGGGAGGG - Intronic
1192632636 X:72789246-72789268 AGGGAGTGACGGAGGGAGGGAGG + Intronic
1192649073 X:72931555-72931577 AGGGAGTGACGGAGGGAGGGAGG - Intronic
1192808328 X:74529092-74529114 ATGGGGTGGTGGGAGGGGGAAGG - Intronic
1192906931 X:75561412-75561434 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
1192977860 X:76305305-76305327 GTGGAGTGGGGGGAGGAGGGAGG - Intergenic
1193054142 X:77132124-77132146 ATGGGGTGGCGGAGGGGAGAGGG - Intergenic
1193055068 X:77141249-77141271 GTGGAGTGGGGGGAGGGGGAAGG + Intergenic
1193069123 X:77289182-77289204 ATGGGGTGGCGGGAGGGGGGAGG - Intergenic
1193601538 X:83512572-83512594 ATGGAGAGGAAGAAGAAGGATGG - Intergenic
1193786570 X:85767033-85767055 GTGGGGTGGGGGAAGGAGGGAGG - Intergenic
1194337227 X:92663052-92663074 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1194650018 X:96503352-96503374 AGGGAGTGGGGAAGGGAGGAAGG + Intergenic
1194903188 X:99540672-99540694 ATGGAGTCCCAGAAGGAGAAAGG + Intergenic
1195306112 X:103585661-103585683 CTGGAATGGCGGAAGGGGAACGG + Intronic
1195421968 X:104685619-104685641 CTGGGGTGGGGGAAGGGGGAAGG + Intronic
1195698342 X:107683268-107683290 ATTTAGTGGGGGAAGGAGGAGGG - Intergenic
1195712711 X:107786982-107787004 AGGGAGAGAAGGAAGGAGGAAGG + Intronic
1195897931 X:109767185-109767207 AAGGAAGGGAGGAAGGAGGAAGG + Intergenic
1195908033 X:109864782-109864804 AGGGAGGGAAGGAAGGAGGAAGG - Intergenic
1195980294 X:110570163-110570185 CTGGGGTGGGGGGAGGAGGAAGG - Intergenic
1196203648 X:112914524-112914546 ATGGGGTGGAGGAAGGGGGAGGG - Intergenic
1196346353 X:114664366-114664388 CTGGAGGTGGGGAAGGAGGAGGG - Intronic
1196603919 X:117633890-117633912 ATGGGGTGGGGGAGGGGGGAGGG + Intergenic
1196632100 X:117953403-117953425 GTGGGGTGGGGGAAGGGGGAAGG + Intronic
1196866888 X:120078459-120078481 TTGGAGTGGGGGCAGTAGGACGG + Intergenic
1196876211 X:120157823-120157845 TTGGAGTGGGGGCAGTAGGACGG - Intergenic
1197059511 X:122160719-122160741 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
1197116364 X:122838265-122838287 ATGGGGTGGGGGGAGGGGGAGGG + Intergenic
1197250348 X:124209452-124209474 AGGGAGGGAGGGAAGGAGGAAGG - Intronic
1197478546 X:126952725-126952747 ATGGAGCGGGGGAGGGGGGAGGG + Intergenic
1197523405 X:127527916-127527938 GTGGAGTGGGGGGAGGGGGAGGG + Intergenic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1197750041 X:129957750-129957772 ATCGAGGGGTGGGAGGAGGAGGG + Intergenic
1198018132 X:132632364-132632386 ATGGTGTGTTGGAAGTAGGAAGG + Intronic
1198457906 X:136835585-136835607 AGGGAGGGAGGGAAGGAGGAAGG + Intergenic
1198677566 X:139146968-139146990 GTGGGGTGGGGGAGGGAGGAGGG + Intronic
1198705250 X:139441676-139441698 GTGGGGTGGCGGGAGGGGGAAGG + Intergenic
1198957155 X:142145920-142145942 AGGGAGGGACGGAGGGAGGAAGG + Intergenic
1199396167 X:147341192-147341214 AAGGAGAGAGGGAAGGAGGAAGG - Intergenic
1199555057 X:149098138-149098160 AAGGAGAGAAGGAAGGAGGAAGG + Intergenic
1199693367 X:150326148-150326170 ATGTGGTGGTGGAAGGAGGAGGG - Intergenic
1199733718 X:150664175-150664197 ATGGAGTGGAGGTGGGAGAATGG - Intronic
1199838506 X:151619038-151619060 ATGGAGTGGTGGCAGGGGCATGG + Intronic
1199863034 X:151819221-151819243 ATAGAGTGAGGGAAGGAGGGAGG + Intergenic
1201292037 Y:12429902-12429924 AAGGAGGGAAGGAAGGAGGAAGG - Intergenic
1201341100 Y:12935498-12935520 AAGGAGGGAGGGAAGGAGGAAGG - Intergenic
1201451137 Y:14116173-14116195 ATGGAGTGAGGGAGGGAGGGAGG + Intergenic
1201454564 Y:14155481-14155503 ATGGGGTGGGGGGAGGAGGGAGG + Intergenic
1201478890 Y:14415874-14415896 ATGGAGTGAGGGAAGGAGCGAGG - Intergenic
1201538902 Y:15084739-15084761 AGGGAGGGAGGGAAGGAGGAAGG + Intergenic
1201690577 Y:16760250-16760272 AAGGAGGGAGGGAAGGAGGAAGG - Intergenic
1201711794 Y:17000635-17000657 AAGGAGGGAGGGAAGGAGGAAGG - Intergenic
1201739331 Y:17306743-17306765 AGGGAGGGAAGGAAGGAGGAAGG + Intergenic