ID: 935150131

View in Genome Browser
Species Human (GRCh38)
Location 2:100426657-100426679
Sequence GGCCACGGAGGCTGCTCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935150131_935150140 28 Left 935150131 2:100426657-100426679 CCATCTGAGCAGCCTCCGTGGCC No data
Right 935150140 2:100426708-100426730 CATGCATCTTACTGTAACCCGGG No data
935150131_935150142 30 Left 935150131 2:100426657-100426679 CCATCTGAGCAGCCTCCGTGGCC No data
Right 935150142 2:100426710-100426732 TGCATCTTACTGTAACCCGGGGG No data
935150131_935150141 29 Left 935150131 2:100426657-100426679 CCATCTGAGCAGCCTCCGTGGCC No data
Right 935150141 2:100426709-100426731 ATGCATCTTACTGTAACCCGGGG No data
935150131_935150137 2 Left 935150131 2:100426657-100426679 CCATCTGAGCAGCCTCCGTGGCC No data
Right 935150137 2:100426682-100426704 CCGGAGTCCGTGAGACTGAAAGG No data
935150131_935150139 27 Left 935150131 2:100426657-100426679 CCATCTGAGCAGCCTCCGTGGCC No data
Right 935150139 2:100426707-100426729 TCATGCATCTTACTGTAACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935150131 Original CRISPR GGCCACGGAGGCTGCTCAGA TGG (reversed) Intergenic