ID: 935153053

View in Genome Browser
Species Human (GRCh38)
Location 2:100456470-100456492
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 464
Summary {0: 4, 1: 15, 2: 47, 3: 80, 4: 318}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902970931 1:20049162-20049184 TAGTCCTAGAATAAAATGACTGG + Intronic
903394926 1:22993286-22993308 CTGTCCTAGAATAAAATGACTGG + Intergenic
904308434 1:29607351-29607373 TTGTCCTAAAATAAAATGACTGG + Intergenic
904764893 1:32837996-32838018 AATATCTAGAGTAAAATGACTGG + Intronic
905579800 1:39075656-39075678 TAGTCCTAAAATAAAATGACTGG - Intergenic
906498726 1:46324496-46324518 TTGTCCTAGAGTGAAATGACTGG + Intergenic
906737048 1:48140144-48140166 TTGTCCTGGAGTAAAATGACTGG + Intergenic
908142031 1:61195321-61195343 TAGCCATATAAGAAAATGACAGG + Intronic
908702380 1:66916122-66916144 TAGTCCTAAAATAAAATGACTGG + Intronic
909050936 1:70767173-70767195 TTTTCCTAGAATAAAGTGACAGG + Intergenic
909276493 1:73693603-73693625 TAAAGATAGAAAAAAATGACTGG + Intergenic
909684259 1:78328886-78328908 AAGACCTAGAATCAAAAGAAAGG - Intronic
910035277 1:82781011-82781033 TTATCCTAGAATAAACTGACTGG + Intergenic
910436949 1:87215067-87215089 TAGACCTAAAATAAAATTACCGG - Intergenic
910554311 1:88513947-88513969 TAAACATAGAATAAAATGGATGG - Intergenic
910617145 1:89211128-89211150 TTGTCCTAAAATGAAATGACTGG + Intergenic
911159048 1:94665326-94665348 TTGACCTAAAATAAAATAACTGG - Intergenic
912493759 1:110078000-110078022 TAGACCTTGAACTGAATGACAGG + Intergenic
913087273 1:115450673-115450695 TGGACCTAGAGAAAAATGTCTGG + Intergenic
914992276 1:152509200-152509222 TATATATAGAAAAAAATGACGGG + Intergenic
915665889 1:157444838-157444860 TAGTCCTAGAATAAAATGACTGG - Intergenic
916208363 1:162337102-162337124 TAGAGCTAGAAGAAAATGACAGG - Intronic
916624366 1:166538412-166538434 AAGTCCTGGAATAAAATGACTGG - Intergenic
917026509 1:170648995-170649017 ATGACCCAGAATAAAATGTCTGG + Intergenic
917293729 1:173496857-173496879 TTGTCCTAAAGTAAAATGACTGG + Intergenic
917652464 1:177092012-177092034 TGTACCTAAAATAAAATGACTGG + Intronic
918361934 1:183768248-183768270 TTGTCCTAAAATAAAATAACTGG - Intronic
918465137 1:184813598-184813620 TTGTCCTAAAGTAAAATGACTGG + Intronic
918589560 1:186225096-186225118 TTGTCCTAAAGTAAAATGACTGG + Intergenic
919587178 1:199453169-199453191 ATGACATAGAATAAAATTACAGG - Intergenic
921077287 1:211710240-211710262 TTGTCCTAGAGTAAAATGAATGG + Intergenic
921378367 1:214498184-214498206 TAGAGCTAGATAAAAATCACAGG + Intronic
921732112 1:218590262-218590284 TAGACATAGAATAATATTACAGG - Intergenic
922274974 1:224069229-224069251 TTGACATAGAATAACAGGACTGG + Intergenic
922600760 1:226850867-226850889 TAGTCCTAAAATAAAATGACTGG + Intergenic
924657947 1:245990466-245990488 TCGACCTTGAATAAAATTTCTGG + Intronic
924929398 1:248714338-248714360 TAGTCCTAGAATAAAATGACTGG + Intergenic
1064772988 10:18743522-18743544 TATACCTAGAACAAAATGTCTGG - Intergenic
1064910124 10:20392085-20392107 TATACCAAGAGTAAAATAACTGG - Intergenic
1065806473 10:29397874-29397896 TGGACGTTGAAAAAAATGACAGG + Intergenic
1068674529 10:59756796-59756818 TTGTCCTAAAGTAAAATGACTGG + Intergenic
1068898031 10:62229330-62229352 AAGATCTAGAATACAATCACGGG + Intronic
1070953009 10:80445906-80445928 TAGGCCAAGTATAGAATGACAGG + Intergenic
1070961360 10:80502308-80502330 CAGACCTAGAAGAAAATGCACGG - Intronic
1071377749 10:85026973-85026995 TTGTCCTAAAATAAAATAACTGG + Intergenic
1071716093 10:88097144-88097166 TAGACCTCCAAAATAATGACTGG - Intergenic
1071898336 10:90089552-90089574 TAGTCCTAGAGTAAAATGACTGG + Intergenic
1073738319 10:106376897-106376919 TAGTCATAAAATAAAATAACTGG + Intergenic
1073892829 10:108120710-108120732 TTGTGCTAGAGTAAAATGACCGG - Intergenic
1074649493 10:115503796-115503818 TAGTCCTATAATAAAATAACTGG - Intronic
1074660856 10:115655862-115655884 TAGACAAAGGATAAAATTACAGG - Intronic
1077534375 11:3114357-3114379 TAGTCCTAGAGTAAAATGACTGG + Intronic
1078311525 11:10248220-10248242 TAAAGCTAAAGTAAAATGACTGG + Intronic
1078409622 11:11103033-11103055 TAGACCTAGGAAAAAATGATAGG + Intergenic
1078948106 11:16094647-16094669 GAGAGCTAGAAAGAAATGACTGG - Intronic
1079154359 11:17930694-17930716 TACACCTAGAATCAGATGACAGG + Intronic
1079583422 11:22094755-22094777 TTGTCCTAAAGTAAAATGACTGG - Intergenic
1081078889 11:38713888-38713910 TAGCCCTAATACAAAATGACTGG + Intergenic
1081168864 11:39841669-39841691 TAGACCTACAAAAAAATCCCTGG - Intergenic
1082634084 11:55575895-55575917 TAGTCCTAAAATAAAATGACTGG - Intergenic
1082737137 11:56868752-56868774 TTATCCTAGAATAAAATGACTGG + Intergenic
1082950792 11:58813812-58813834 TAGTCTGAGAATAAAATGACTGG + Intergenic
1082994496 11:59240414-59240436 TTGGCCTAGAGTAAAATGACTGG + Intergenic
1083382833 11:62280565-62280587 TTGTCCTAAAATGAAATGACTGG + Intergenic
1084286114 11:68132142-68132164 TTGTCCTAGAGTAGAATGACTGG + Intergenic
1085573470 11:77580840-77580862 TAGACCAAGAATAAAATGAGTGG + Intronic
1085849820 11:80107138-80107160 TAGACTTTGAATAAAATACCTGG - Intergenic
1086238359 11:84659366-84659388 TAGACCTAGAGCAAACTGAAAGG - Intronic
1086741253 11:90371928-90371950 ATGACCTAGAATAAAATGGGGGG - Intergenic
1087049874 11:93875405-93875427 TAGTCCTAGAGTGGAATGACTGG - Intergenic
1087146326 11:94815819-94815841 TTTTCCTAGAATAAAATGACTGG + Intronic
1088532099 11:110821453-110821475 TAGACCAGGAATATCATGACAGG - Intergenic
1088962466 11:114683255-114683277 TAGTCCTAGAGTAAAATGACTGG - Intronic
1090100522 11:123791479-123791501 TAGACGTATAATAAAATGACTGG - Intergenic
1090290834 11:125542822-125542844 TTGTTCTAAAATAAAATGACTGG + Intergenic
1091566531 12:1652779-1652801 TAGACCTTGAATGCTATGACAGG + Intergenic
1093708268 12:22299416-22299438 TAGTCTTAGAATAAAAGGTCTGG + Intronic
1094166587 12:27449776-27449798 TTGTCCTATAATACAATGACAGG + Intergenic
1094433101 12:30391805-30391827 TAGTCCTAAAGTAAAATGAATGG + Intergenic
1094468006 12:30774706-30774728 TAGACCTAGAATACAATGACTGG + Intergenic
1095266462 12:40164290-40164312 TAGCCCTAGAGTAACATGACTGG - Intergenic
1095855705 12:46858614-46858636 TAGCTCTAGAGTAAAATGAATGG - Intergenic
1097254355 12:57661368-57661390 TTGTCCTAAAGTAAAATGACTGG + Intergenic
1098666194 12:73166218-73166240 TAGTCCTAGAATAAAATGACTGG + Intergenic
1098834452 12:75405198-75405220 TTGTCTTAAAATAAAATGACTGG + Intronic
1099436862 12:82656371-82656393 TTGCCCTAAAGTAAAATGACTGG - Intergenic
1100047153 12:90396380-90396402 TAAAGCTAGTATAAAAAGACTGG + Intergenic
1101188591 12:102307624-102307646 TTGTCCTAAAGTAAAATGACTGG + Intergenic
1103181219 12:118913568-118913590 TAGCCCTAGAATAAAAGCCCAGG - Intergenic
1104764854 12:131322248-131322270 TAGTCCTCAAATAAAATGACTGG - Intergenic
1105697020 13:22898710-22898732 TTGTCCTAAAATAAAATGACTGG + Intergenic
1107116541 13:36753264-36753286 TAGACCCAGAACATAATGAGGGG + Intergenic
1107281110 13:38736302-38736324 TGGACCTAAAAACAAATGACTGG + Intronic
1107529512 13:41269036-41269058 TAGTTCTAGACTAAAATGACTGG - Intergenic
1107682719 13:42867834-42867856 TATACCTAGACTAAAATGTCCGG - Intergenic
1107765242 13:43727388-43727410 TAGACATAGATAAAAATGAACGG + Intronic
1108383578 13:49877691-49877713 TTGTCCTAAAGTAAAATGACTGG + Intergenic
1108508027 13:51130423-51130445 TTGTCCTAAAGTAAAATGACTGG + Intergenic
1109949826 13:69486065-69486087 TTGTCCTAAAATAAAACGACTGG + Intergenic
1110049941 13:70884282-70884304 TTGTCCTAAAGTAAAATGACTGG + Intergenic
1110522144 13:76492208-76492230 TAGACATAGAAGTAAATGAATGG + Intergenic
1110593819 13:77295503-77295525 CAAACCTAAAATAAAATGAAAGG - Intronic
1112413487 13:99184520-99184542 TAGTCCTAAAATAAAATAACTGG - Intergenic
1112447614 13:99479360-99479382 TAGTCCTAGGGTAAAATGACTGG + Intergenic
1112669993 13:101624541-101624563 CAGAGGTAGAATAAAATGAAAGG + Intronic
1113202589 13:107883507-107883529 GAGACCCGGAATAAAAAGACGGG + Intergenic
1114049426 14:18910468-18910490 TAGATCTAGAATATAATTATTGG - Intergenic
1114053003 14:18938539-18938561 TAGTCCTAAAATAAAATAACTGG + Intergenic
1114109554 14:19463387-19463409 TAGTCCTAAAATAAAATAACTGG - Intergenic
1114113137 14:19491463-19491485 TAGATCTAGAATATAATTATTGG + Intergenic
1114565097 14:23624893-23624915 TTGTCCTAAAGTAAAATGACTGG + Intergenic
1114589896 14:23853476-23853498 TTGTCCTAAAGTAAAATGACTGG + Intergenic
1114661405 14:24347523-24347545 TAAACTTAGAATGACATGACAGG - Intergenic
1115291905 14:31781852-31781874 TTGTCCTAAAGTAAAATGACTGG - Intronic
1117089135 14:52232401-52232423 TTCGCCTAGAATAAAATGAAAGG - Intergenic
1117187681 14:53257843-53257865 GAGTCCTAGAGTAACATGACTGG - Intergenic
1118118427 14:62807727-62807749 TTGTCCTAAAGTAAAATGACTGG + Intronic
1118486271 14:66216863-66216885 TTGTCCTAAAGTAAAATGACTGG + Intergenic
1118937850 14:70304008-70304030 TAGACCTAGAATAAAATGACTGG + Intergenic
1119822952 14:77634430-77634452 TTGTCCTAAAATAAAATAACTGG - Intergenic
1119952423 14:78758933-78758955 TACACCAAGAACAAAATGAAAGG - Intronic
1121147545 14:91598096-91598118 TAGTCCTAAAATAAAATAACTGG - Intronic
1121905907 14:97744021-97744043 TAAACCTTGAATAACACGACGGG - Intergenic
1122186773 14:100004645-100004667 CAGTCCTAGAATAAAATGACTGG - Intronic
1122434181 14:101681503-101681525 TTGTCCTAGAATAAAATGACTGG - Intergenic
1122949961 14:105037864-105037886 TTGTCCTAGAATAAAATGACTGG + Intergenic
1124062801 15:26310174-26310196 TTCACCTAGAATAAAATGGCTGG + Intergenic
1124091789 15:26611577-26611599 TTGTCCTAAAGTAAAATGACTGG + Intronic
1124843979 15:33272620-33272642 AAAACAAAGAATAAAATGACAGG - Intergenic
1124990078 15:34664247-34664269 AATACCTAGAATGAAATGGCTGG - Intergenic
1125085041 15:35720160-35720182 GAGACCTAGAAAAAAATGCCTGG - Intergenic
1126708047 15:51425320-51425342 TAGTCCCAGAATAAAATGACTGG - Intergenic
1130426815 15:83809715-83809737 TAGACCCAAATCAAAATGACAGG + Intronic
1136936860 16:34476889-34476911 GAGAGCTAGAATAAAGTGAATGG - Intergenic
1136962959 16:34871681-34871703 GAGAGCTAGAATAAAGTGAATGG + Intergenic
1138015470 16:53424272-53424294 TTGTCCTAAAGTAAAATGACTGG - Intergenic
1138632419 16:58309061-58309083 TTGTCTTAAAATAAAATGACTGG + Intronic
1138766938 16:59616385-59616407 TAGACCCAGAAAAAAATATCAGG + Intergenic
1138850631 16:60625366-60625388 TAAAACTAGAAATAAATGACAGG + Intergenic
1140299451 16:73741887-73741909 AAGACTTAGAATAAAATCAGCGG - Intergenic
1142347438 16:89562866-89562888 TAGACCTAGAAGAGAAAGACAGG - Exonic
1145227099 17:21138544-21138566 TAGTCCTAAAATAAAATGACTGG - Intronic
1146135867 17:30320414-30320436 GAGACCCAGAAAAAAATGATTGG + Intronic
1148810344 17:50286334-50286356 TAGACACAGAAGAAAATGATAGG - Intergenic
1148951077 17:51313203-51313225 TAGTCCTAGAATAAAATGACTGG + Intergenic
1149156175 17:53632439-53632461 TTGTCCTAGAAGGAAATGACTGG + Intergenic
1149472539 17:56929477-56929499 TAGTCCTAAAGTAAAATAACTGG + Intergenic
1149746212 17:59101098-59101120 TATACCTAATAAAAAATGACTGG + Intronic
1150423678 17:65059482-65059504 TATACCCAGGATAAAATTACTGG - Intergenic
1153156602 18:2157126-2157148 TTGTCCTAAAACAAAATGACTGG + Intergenic
1153745947 18:8179791-8179813 TTGTCCTAAAGTAAAATGACTGG - Intronic
1154400394 18:14031496-14031518 CAGATCTAAAATAAAATAACTGG - Intergenic
1156107631 18:33684874-33684896 TAGAATTTGAATAAAATGAATGG + Intronic
1156452753 18:37275731-37275753 GAGACCTAGAAGAAGAGGACTGG - Intronic
1156528453 18:37791563-37791585 TGGAACTTGAATCAAATGACTGG + Intergenic
1157323971 18:46656152-46656174 CAGACCTAGTATGAGATGACAGG + Intronic
1157730920 18:50003511-50003533 TAAACCTAGAGGATAATGACAGG + Intronic
1158167007 18:54551848-54551870 TTGACCTAAAATAAAATGACTGG - Intergenic
1158178476 18:54685182-54685204 TAGACGTGGAATAAAATGTTGGG - Intergenic
1158483334 18:57842410-57842432 TATACCTAACACAAAATGACTGG + Intergenic
1159061999 18:63524700-63524722 TTGTCCTAAAATAAAATGACTGG - Intergenic
1159792920 18:72806218-72806240 TAAACCTAAAATAAAGTGATTGG - Intronic
1159843246 18:73425779-73425801 TTGCCCCAGAATAAAATGAAGGG - Intergenic
1160126706 18:76180743-76180765 TTGTCCTAAAGTAAAATGACTGG - Intergenic
1163999858 19:21088295-21088317 TTATCCTAAAATAAAATGACTGG - Intronic
1165190625 19:34059985-34060007 TAGAACTAGGACAAAATGATGGG + Intergenic
1165710833 19:38009714-38009736 TAGAGCCAGAATCAAATCACAGG - Intronic
1166029101 19:40112574-40112596 TTGTCCTAAAGTAAAATGACTGG - Intergenic
1168216785 19:54932005-54932027 TAAACATGAAATAAAATGACAGG - Intronic
1168379016 19:55904525-55904547 TAGAACGAGAGTAGAATGACAGG - Intronic
926456157 2:13070793-13070815 TTGTCCTAGAATAAAGTGACTGG + Intergenic
926564914 2:14458254-14458276 TTGTCCTAGAATAAAATGACTGG + Intergenic
927214032 2:20656206-20656228 TAGGCATAGAAAAAAATGTCAGG - Intergenic
928113375 2:28527752-28527774 CAGACTTAAAACAAAATGACTGG + Intronic
928799991 2:35077478-35077500 AATACTTAGATTAAAATGACTGG + Intergenic
929351711 2:40964435-40964457 TAGAACTATATTAAAATGAAAGG - Intergenic
929535153 2:42778014-42778036 TAGTTGTAGAGTAAAATGACTGG + Intronic
930494783 2:52127287-52127309 TAGAACTAGAAAAAAAAGACTGG - Intergenic
930767425 2:55098117-55098139 TAGCCCTAATCTAAAATGACTGG - Intronic
930809274 2:55524046-55524068 CAGAACTAGAATAAGATCACAGG + Intronic
932089561 2:68793370-68793392 TAAAGCTAGAATAAAATCAAGGG - Intronic
932869696 2:75386185-75386207 TTGTCCTAAAATAAAATGTCTGG - Intergenic
933535498 2:83567953-83567975 TTGACTTATAATAAAATCACTGG + Intergenic
933614233 2:84467717-84467739 TTGTCCTAAAGTAAAATGACTGG - Intergenic
934104551 2:88683540-88683562 TTGTCCTAAAGTAAAATGACTGG + Intergenic
934108749 2:88722074-88722096 TGGGCCTAGAATAAAATGACTGG - Intronic
934549608 2:95248837-95248859 TTGTCCTAAAATAAAATGACCGG - Intronic
934889072 2:98050088-98050110 TTGTCCTAAAGTAAAATGACTGG + Intergenic
935153053 2:100456470-100456492 TAGACCTAGAATAAAATGACTGG + Intergenic
935962568 2:108441571-108441593 TTGTCCTAAAATAAAATGACTGG - Intergenic
936477975 2:112857464-112857486 TTGTGCTAGAATAAAGTGACTGG + Intergenic
936491655 2:112977686-112977708 TAGCTCTAGAATGACATGACAGG + Intronic
936753928 2:115681126-115681148 TAGCCGTAGTAAAAAATGACTGG + Intronic
936867241 2:117088589-117088611 TATAACTAAAATAAAATGAGAGG - Intergenic
937579752 2:123470448-123470470 TTGTCCTAGAATAAAATGACTGG + Intergenic
938176076 2:129130609-129130631 TTGTCCTAAAGTAAAATGACTGG + Intergenic
938550077 2:132372037-132372059 AAGCCCTAAAATAAAATAACTGG - Intergenic
939339353 2:140874007-140874029 TAGTCCTAGAACAAAATGACTGG + Intronic
940460319 2:153956525-153956547 TTGCCCTAGAGTAAAATGACTGG - Intronic
940601162 2:155862547-155862569 TATACATAGAAAAAAATAACTGG + Intergenic
940602481 2:155879568-155879590 TAAACTGAAAATAAAATGACGGG + Intergenic
942329385 2:174806088-174806110 CTGCCCTAGAATAAAAGGACAGG - Intronic
943018017 2:182537874-182537896 TACACCTAGAACAAAATTCCAGG - Intergenic
943143765 2:184016197-184016219 TAGACATGGATTAAAATGGCAGG + Intergenic
944177814 2:196852797-196852819 TTGTCCTAAAGTAAAATGACTGG + Intronic
944410538 2:199437809-199437831 TAGGCCTTGAAAAAAATTACTGG - Intronic
945247859 2:207736803-207736825 TAGAACTTGTATAAAATGAAAGG + Intronic
945606915 2:211944944-211944966 TATACCTGGTATAAAATGAGGGG - Intronic
945808034 2:214514429-214514451 TAGACAGAGACTAAAATGAATGG - Intronic
945869415 2:215210172-215210194 TTGTCCTAGAATAAAATGACTGG + Intergenic
945869941 2:215216361-215216383 CAGACCTAGAAGAATCTGACAGG + Intergenic
946198167 2:218051531-218051553 TTGTCCTAAGATAAAATGACTGG + Intronic
946798401 2:223382412-223382434 TTGTCCTAACATAAAATGACGGG + Intergenic
946806714 2:223477764-223477786 TAGACATAGAATAGAATGTATGG + Intergenic
947287722 2:228535520-228535542 TAGTCCTAGAATAAAATGACTGG + Intergenic
947325170 2:228966448-228966470 TCGACTTAGGAGAAAATGACAGG - Intronic
947759579 2:232593962-232593984 TAGGCCTAAGATGAAATGACAGG - Intergenic
947788571 2:232847767-232847789 TAAACCTAGTGTAAAATGAATGG - Intronic
949029309 2:241783347-241783369 TAGTCCTAGAGTAAAATGACTGG - Intronic
949039345 2:241840155-241840177 TTGTCCTAAAGTAAAATGACTGG - Intergenic
949077023 2:242066654-242066676 AAGAAGTAGAATAAATTGACGGG - Intergenic
1168825075 20:805829-805851 TTGTCCTAGAATAAAATGACTGG + Intergenic
1170659632 20:18324621-18324643 TTGTCCCAAAATAAAATGACTGG + Intergenic
1170867180 20:20168707-20168729 CAGGCCTAGAATAGAATGAATGG + Intronic
1171506526 20:25640029-25640051 TAGTCCTAGAATAAACCGACTGG - Intergenic
1172199829 20:33117474-33117496 TTGTCCTAAAGTAAAATGACTGG - Intergenic
1173122528 20:40306938-40306960 AAGATCTAGAACATAATGACAGG + Intergenic
1176688054 21:9872300-9872322 GAGAGCTAGAATAAAATAAATGG + Intergenic
1177065663 21:16431151-16431173 AATACCTAGAATACAATTACAGG - Intergenic
1177098338 21:16867605-16867627 TAGACCAAAAATAAAATGTTAGG + Intergenic
1177589311 21:23142125-23142147 TTGTCCTAGAATAAAATGAATGG - Intergenic
1177878461 21:26664341-26664363 TTGTCCTAAAATAAAATGACTGG - Intergenic
1178386846 21:32158919-32158941 TTGCCCTAAAATAAAATAACTGG - Intergenic
1179651791 21:42815486-42815508 TAGTCCTAAAATAAAATGACTGG - Intergenic
1180471476 22:15660914-15660936 TAGTCCTAAAATAAAATAACTGG + Intergenic
1181723251 22:24792708-24792730 AAAACCTAGAATAAAATGGCTGG + Intergenic
1183103480 22:35598351-35598373 TGGGCCTTGAGTAAAATGACAGG + Intergenic
1183112876 22:35664992-35665014 TAGTCCTAAAATAAAATAACTGG + Exonic
1183221011 22:36513191-36513213 TGGACCCAGAGTGAAATGACTGG + Intronic
1183302918 22:37067118-37067140 AAGAGCTAGAATAAAGTGACAGG - Intronic
1184576717 22:45374172-45374194 TAGTCCTAGAATAAAATGACTGG + Intronic
1184917615 22:47582161-47582183 TAGTCTTAGAATAAAATGACTGG + Intergenic
951250086 3:20384187-20384209 TTGTTCTAAAATAAAATGACTGG + Intergenic
951300699 3:20992620-20992642 TTGACCTAACATAAAATAACTGG - Intergenic
951833232 3:26953214-26953236 TTGTCCTAGAGTAAAATGACTGG - Intergenic
951984297 3:28601209-28601231 TATACATAGGAGAAAATGACAGG - Intergenic
953604086 3:44397639-44397661 AATACCTAGAATAGAATGGCTGG + Intronic
954839326 3:53496377-53496399 TACACCTAGGATAGACTGACTGG - Intronic
958816280 3:98919814-98919836 TGGACCTAGAATGAAAAGAAAGG + Intergenic
958954051 3:100447708-100447730 TAGTCCTAGAGTAAAATGACTGG - Intronic
959281731 3:104350498-104350520 TAGTCTTGTAATAAAATGACTGG + Intergenic
959970510 3:112404010-112404032 TAGTCCTAGAGTAAAATGACTGG - Intergenic
959980634 3:112512574-112512596 TAGTCCTAGAATAAAATGACAGG - Intergenic
960227938 3:115188775-115188797 TTGTCCTAGAATAAAATAACTGG + Intergenic
960386847 3:117030746-117030768 TTGTCCTAAAGTAAAATGACTGG + Intronic
960709062 3:120508806-120508828 TTGTCCTAAAGTAAAATGACTGG + Intergenic
962729032 3:138262531-138262553 CTGACCTAGACTAAAATGAGAGG - Exonic
963173490 3:142275005-142275027 TAAACCTAAAATAAAATAAAGGG - Intergenic
963744394 3:149111670-149111692 TTGTCCTAAAGTAAAATGACTGG - Intergenic
963760931 3:149286664-149286686 TAGTCCTAAAATAAAATAACTGG + Intergenic
963896531 3:150691534-150691556 TAGTCCTAGAGTAGAATGACTGG + Intronic
964023059 3:152038208-152038230 TAGTCCTACAATAAAATGCCTGG - Intergenic
964218810 3:154320918-154320940 TAAACAAAGAATGAAATGACTGG - Intronic
964641735 3:158915864-158915886 TAGAACTAAAATAGCATGACTGG + Intergenic
964736077 3:159919315-159919337 TATACCTAAAATAAAATTACTGG - Intergenic
964885632 3:161479185-161479207 TAGACCTAGCATAAAAACCCAGG - Intergenic
965089543 3:164144884-164144906 TTGCCCTAAAGTAAAATGACTGG + Intergenic
966759799 3:183407861-183407883 AGGACCTAGACTAGAATGACAGG - Intronic
967244685 3:187473884-187473906 TAGACCTAAAATAAAATGTCTGG + Intergenic
967309979 3:188096577-188096599 TAGATCTAGAAAAAAATAAGAGG + Intergenic
968003480 3:195223781-195223803 TAGTCATAAAATAAAATGAGCGG - Intronic
968043257 3:195606616-195606638 TAGTCCTAGAATAAAATGACTGG + Intergenic
968294497 3:197564206-197564228 TAGTCCTAGAGTAAAATGACTGG + Intronic
969419892 4:7087454-7087476 TTGTCCTAAAGTAAAATGACTGG - Intergenic
969727490 4:8930524-8930546 TAATCCTATAATAAAATGACTGG + Intergenic
970034473 4:11716960-11716982 AAGTCCTAGAAAAAAATCACAGG - Intergenic
970092225 4:12422880-12422902 TTGTCCTAGAATAAAATGACTGG + Intergenic
971272817 4:25166631-25166653 CAGACATAGAAAAAAATAACTGG + Intronic
971955533 4:33413173-33413195 TAGACCTAAAATAAAATGACTGG + Intergenic
972724621 4:41735945-41735967 TAAACCTAAAATAAAAGGCCCGG - Intergenic
972853593 4:43079312-43079334 TAGTCCTAAAATAAAATAACTGG - Intergenic
973245628 4:48008280-48008302 TAGACCTAGAATAAAATGACTGG - Intronic
973814103 4:54602817-54602839 TTGTCCTAAAGTAAAATGACTGG - Intergenic
974423776 4:61713473-61713495 TAGACCTAGAATTAGATCAAGGG - Intronic
974744210 4:66049352-66049374 TAGGACCAGAATAAAATGAGAGG - Intergenic
974960709 4:68696582-68696604 TAGACCTATAACAAAAAGAGAGG - Intergenic
975224984 4:71860898-71860920 TTGTCCTAAAATAAGATGACTGG - Intergenic
977042674 4:92034269-92034291 TAGTCCTAAAATAAAATAACTGG - Intergenic
977674130 4:99729591-99729613 TTGTCCTAAAGTAAAATGACTGG - Intergenic
977761972 4:100748883-100748905 TAATCCCAGAATACAATGACTGG + Intronic
978032301 4:103950011-103950033 TAGTCCTAAAATAAAATAACTGG + Intergenic
978058342 4:104302750-104302772 TGGGCCTAAAATCAAATGACAGG + Intergenic
978216446 4:106210184-106210206 TAGCCTTAGAAGAAAAAGACAGG + Intronic
978357124 4:107888506-107888528 TAGTCCTAGAGTAGAATGACTGG - Intronic
979093268 4:116515407-116515429 TTGTCCTAAAGTAAAATGACTGG - Intergenic
979863774 4:125727109-125727131 TAAACCTTGAATAACATGATAGG - Intergenic
980123119 4:128747796-128747818 TTATCCTAGATTAAAATGACTGG - Intergenic
980269943 4:130571260-130571282 TAGTCCTAGAATAAAATGACTGG - Intergenic
980351425 4:131690140-131690162 GAGAGCTAGAATAAAATAAATGG + Intergenic
980471621 4:133260263-133260285 TAGTCCTAAAATAAAATAACTGG - Intergenic
980545376 4:134255101-134255123 GAGACTGAGAAAAAAATGACAGG - Intergenic
981202598 4:141998537-141998559 TTGTCCTAAAGTAAAATGACTGG - Intergenic
982159687 4:152555181-152555203 TAGAAATATAATAGAATGACAGG - Intergenic
982196497 4:152921028-152921050 CTGCCTTAGAATAAAATGACTGG - Intergenic
982461203 4:155670932-155670954 TGGACCTAGAAAAAAAGGTCAGG - Intronic
982475641 4:155847041-155847063 TAGTCCTAAAATAAAATGACTGG + Intronic
982995084 4:162333637-162333659 TTGTCTTAGAATAAAATTACTGG + Intergenic
983276582 4:165624862-165624884 TGGACCTAGAGTATAATGTCAGG + Intergenic
983425502 4:167579178-167579200 TAGTCCTAGAATAAAATGACTGG - Intergenic
985876504 5:2602669-2602691 TAGACCTGGAAGAAATTGAAGGG - Intergenic
986214304 5:5704702-5704724 TAGACATAAAATAAAATGAACGG - Intergenic
986637056 5:9833872-9833894 TAGAGCAATAATAAAAGGACTGG - Intergenic
987122139 5:14777649-14777671 TAGCATTAGCATAAAATGACTGG - Intronic
987719997 5:21621074-21621096 TTACCCTAAAATAAAATGACTGG + Intergenic
987995846 5:25278531-25278553 TTGTCCAAGAATAAAATGAATGG - Intergenic
988568353 5:32339468-32339490 TTGTCCTAAAATAAAATAACTGG - Intergenic
988769550 5:34418208-34418230 TAGCCCTAAAATAAAATGACTGG + Intergenic
988774006 5:34460169-34460191 TAGTCCTAGAATAAAATGTCTGG - Intergenic
988910965 5:35843130-35843152 TTGTCCTAAAGTAAAATGACTGG - Intergenic
989316732 5:40089386-40089408 TAGTCCTAAAATAGAAAGACTGG + Intergenic
990143972 5:52737667-52737689 TAAACCAAGAATGAAATGTCTGG - Intergenic
990186019 5:53210391-53210413 TTGCCCTAAAATAAAATAACTGG - Intergenic
990680707 5:58241010-58241032 TAGACCTAGAATAGTAGAACTGG - Intergenic
992539921 5:77754170-77754192 TTATCCTAAAATAAAATGACTGG - Intronic
995356970 5:111249729-111249751 TAGCCCTAAAATAAAATGTATGG - Intronic
996244954 5:121250855-121250877 TTGATCTAGACTAAAATGAAAGG + Intergenic
998640841 5:144009353-144009375 TTGTCCTAAAGTAAAATGACTGG - Intergenic
999053574 5:148549905-148549927 TTGACAAAGAAAAAAATGACAGG + Intronic
999358547 5:150960905-150960927 CTGTCCTAGAATAAAATGACTGG + Intergenic
999643119 5:153691509-153691531 TATAACTAGAATGAAAAGACTGG + Intronic
1001018736 5:168164861-168164883 TATCCCTAGAATTCAATGACTGG - Intronic
1003014146 6:2454494-2454516 TAGTCCTAAAATGAAATGACGGG + Intergenic
1003884035 6:10504927-10504949 TATACACAGAATAAAAAGACTGG - Intronic
1004470519 6:15924843-15924865 TGCACCTAGAATGAAATAACAGG + Intergenic
1004646408 6:17565723-17565745 TAGCCCTAGAGTAAAATGACTGG - Intergenic
1005594335 6:27364391-27364413 TAGACCTAGATTCAAATCCCAGG + Intergenic
1006819506 6:36880814-36880836 TTGTCCTAAAGTAAAATGACTGG + Intronic
1008455616 6:51707473-51707495 TAGACTTAGAGTAAAAGTACGGG - Intronic
1008600359 6:53088011-53088033 TTGTCCTAAAGTAAAATGACTGG - Intronic
1009324061 6:62328333-62328355 GAGACATAGAAAAGAATGACAGG - Intergenic
1009726791 6:67544964-67544986 TTGCCCTAAAGTAAAATGACTGG + Intergenic
1010174814 6:73016073-73016095 AAGACCTAGAATAAACAAACAGG + Intronic
1010452847 6:76021897-76021919 AAGACCTAGAATAAAAGGGGAGG - Intronic
1010560052 6:77338211-77338233 TACACATAGAATAAAATTAAAGG - Intergenic
1011122884 6:83973793-83973815 TTGCCCTAAAATAAAATGCCTGG - Intergenic
1011286228 6:85726465-85726487 TTGCCCTAAAATAAAATGACTGG - Intergenic
1011415111 6:87110748-87110770 TTGTCCTAAAATAAAATGACTGG + Intergenic
1011462204 6:87616546-87616568 AGAACCTAGAATAAAATAACTGG - Intronic
1012009379 6:93762295-93762317 TACACATAAAACAAAATGACAGG - Intergenic
1012032634 6:94092034-94092056 TAGACCTTGAATAACATCATGGG + Intergenic
1012459712 6:99447146-99447168 TAGATCTGGAAGAAAATTACGGG + Intronic
1012713181 6:102634336-102634358 TTGGCCTAGAGTAAAATGACTGG + Intergenic
1014133104 6:117857221-117857243 TAGTCCCAAAATAAAATAACTGG - Intergenic
1014280351 6:119436159-119436181 TAGAATTAGAACAAAATGAAAGG + Intergenic
1014592477 6:123291237-123291259 TTGTCCTAGAGTAACATGACTGG + Intronic
1014594005 6:123310192-123310214 TAAACCTTGACTAAAATGATGGG + Intronic
1016854507 6:148653223-148653245 TTGTCCTAAAGTAAAATGACTGG + Intergenic
1018179718 6:161211520-161211542 TAGTCCTAGAGTAAAATGACTGG + Intronic
1018764130 6:166917937-166917959 TTGTACTAAAATAAAATGACTGG + Intronic
1020340732 7:7107616-7107638 CAGTCCTAAAATAAAATGACTGG + Intergenic
1022418249 7:30196688-30196710 TTGGCCTAAAGTAAAATGACTGG - Intergenic
1022457561 7:30572335-30572357 TTGGCCTAGAATAAAACGACTGG + Intergenic
1022678027 7:32518658-32518680 TTTTCCTAAAATAAAATGACAGG + Intronic
1023104878 7:36754096-36754118 TATATCTAGAATAAACTTACAGG - Intergenic
1023588557 7:41757070-41757092 TCGTCCTAAAGTAAAATGACTGG - Intergenic
1023668039 7:42545382-42545404 TTGTCCTAAAGTAAAATGACTGG - Intergenic
1024181565 7:46900499-46900521 TAGAACTAGAATCACATGATGGG + Intergenic
1024542391 7:50488503-50488525 TTGTCCTAAAATAAAATCACTGG + Intronic
1024821832 7:53340326-53340348 TAGTCTTAGAATAAAATTACTGG + Intergenic
1025768963 7:64485592-64485614 TTGTCCTAAAGTAAAATGACTGG + Intergenic
1027818351 7:83008789-83008811 TATACATAGACAAAAATGACTGG + Intronic
1029811022 7:103049098-103049120 TTGTCCTAAAGTAAAATGACTGG - Intronic
1030782693 7:113621281-113621303 TAGTCCTAAAGTAAAATGACTGG - Intergenic
1031186433 7:118485756-118485778 TAGACTTAGAGGAAAATGATAGG - Intergenic
1031305222 7:120117488-120117510 TTGTCCTAAAGTAAAATGACTGG + Intergenic
1031621954 7:123945080-123945102 TTGTCCTAAAATAAAATGACTGG - Intronic
1032088644 7:128897865-128897887 TTGTCCTAAAGTAAAATGACTGG + Intronic
1032248925 7:130236283-130236305 CAGACCTTGACTAAAAGGACAGG + Intergenic
1032871085 7:135986390-135986412 TTGTCCCAAAATAAAATGACTGG - Intergenic
1036295644 8:7533803-7533825 TTGCCCTAGAATAAAATGACTGG - Intergenic
1036326924 8:7787216-7787238 TTGCCCTAGAATAAAATGACTGG + Intergenic
1038028235 8:23611897-23611919 TAAACCTAGAATAAAAGAACTGG - Intergenic
1038891901 8:31734827-31734849 GAGACTTAGAATAAAAAAACAGG - Intronic
1041297164 8:56369346-56369368 TAGTGCTGGAATAAAATGACTGG - Intergenic
1041651042 8:60303276-60303298 TAGTCCTAAAATAAAACTACTGG - Intergenic
1042664240 8:71188999-71189021 TAGACTTTGAAGAAAATTACAGG - Intergenic
1043070377 8:75629571-75629593 TTGTCCTAAAGTAAAATGACTGG - Intergenic
1043298575 8:78698092-78698114 AAGAGCTAGCATAAAATGAGAGG - Intronic
1043677158 8:82971459-82971481 TTGTCCTAGAATAAGGTGACTGG - Intergenic
1043749176 8:83913787-83913809 TTGTCCTAAAGTAAAATGACTGG + Intergenic
1044407259 8:91842434-91842456 TAGAAATAAAATAAAATGAAAGG + Intergenic
1046417962 8:113940258-113940280 TAGATCTAGAAGCAAATGAGAGG + Intergenic
1047531166 8:125677444-125677466 TATACCTAGAATTAAATTGCTGG - Intergenic
1048480448 8:134785947-134785969 TAGAAGTAGACTAAAATGAATGG - Intergenic
1049448689 8:142645787-142645809 TAGTCCTACAGTAAAATGAGTGG - Intergenic
1050402911 9:5275271-5275293 TAGACATAGAATTAAAAGTCTGG + Intergenic
1050651120 9:7778039-7778061 TAGTCCTAAAATATAATGTCAGG - Intergenic
1051831786 9:21287276-21287298 GACACCTAGAATTAAAAGACGGG + Intergenic
1052206748 9:25850983-25851005 TAGTCCTAGAGTAAAATGATTGG + Intergenic
1052331695 9:27276649-27276671 TAGTCCTAGAATAATAAAACTGG + Intergenic
1052485549 9:29094699-29094721 TAGAATTAGAATAAAATTATTGG - Intergenic
1053059354 9:35018001-35018023 TTGTCCTGAAATAAAATGACTGG - Intergenic
1053075499 9:35130365-35130387 TAGTCCTAAAATAAAATGACTGG + Intergenic
1053781290 9:41609572-41609594 GAGAGCTAGAATAAAATAAATGG - Intergenic
1054169236 9:61819724-61819746 GAGAGCTAGAATAAAATAAATGG - Intergenic
1054668298 9:67761092-67761114 GAGAGCTAGAATAAAATAAATGG + Intergenic
1054933115 9:70656996-70657018 TAGTCCTAGAATAAAATGACTGG + Intronic
1055602008 9:77929485-77929507 TTTACCTAGAAAAAAAAGACTGG - Intronic
1056723082 9:89088208-89088230 AAGACCTGGAATCAAATGAAAGG - Intronic
1056868428 9:90253310-90253332 TGGACCTAGAATCAATAGACGGG - Intergenic
1057235911 9:93360003-93360025 TAGTCCTAAAATAAAATGACTGG + Intergenic
1057467391 9:95327562-95327584 TAGTCCTAAAATAAAATGACTGG - Intergenic
1058098500 9:100890932-100890954 TAGAACTTCAATAAAAAGACTGG + Intergenic
1058300145 9:103361379-103361401 TAGACCTAGAAAACCAGGACAGG - Intergenic
1062259445 9:135653365-135653387 TTGTCCTAAAATAAAATGACTGG + Intergenic
1185739998 X:2524015-2524037 GTGACCTTGAATAAAATGAGAGG - Intergenic
1186783511 X:12937215-12937237 TTGTCCTAGAATAAAATGACTGG - Intergenic
1187224767 X:17364705-17364727 AAAACCTAGAATAAATTGACAGG - Intergenic
1187616316 X:20997915-20997937 TAGCCCTAAAATAAAATGACTGG + Intergenic
1187816458 X:23237835-23237857 TAGACCTAGAATAAAATGACTGG + Intergenic
1188216225 X:27480652-27480674 TAGACCTAGAATAAAGTCTAGGG - Intergenic
1188752487 X:33921857-33921879 TTGTCCTAAAGTAAAATGACTGG - Intergenic
1188782000 X:34296788-34296810 TAAAATTAGAATTAAATGACTGG + Intergenic
1188904562 X:35776475-35776497 TAATTCTAAAATAAAATGACTGG - Intergenic
1189449419 X:41114189-41114211 TAAACCTTGAATAACATTACGGG + Intronic
1189691419 X:43620902-43620924 TAGGCCTAGAATAAAATGACTGG - Intergenic
1190570213 X:51773653-51773675 TTGTCCTAAAATAAAATGACTGG + Intergenic
1190956251 X:55196941-55196963 TAGTCCTAAAATAAAATGACTGG - Intronic
1190963268 X:55273234-55273256 TTGTCCTAAAGTAAAATGACTGG + Intronic
1190963412 X:55274613-55274635 TTGTCCTAAAGTAAAATGACTGG + Intronic
1191871914 X:65753278-65753300 TTGTCCTAAAATAAAATAACTGG + Intergenic
1192264299 X:69528659-69528681 TGGACCAAGTGTAAAATGACAGG + Intronic
1192803374 X:74488717-74488739 TTGTCCTAAAATAAAATGACTGG - Intronic
1193147208 X:78089771-78089793 TAGACTGAGATTAAAAGGACAGG - Intronic
1193474987 X:81952537-81952559 TAGTCCTAGAGTAAAATGTCTGG + Intergenic
1193532015 X:82666627-82666649 TAGTCCTAAAATAAAATGACTGG - Intergenic
1193572729 X:83163067-83163089 TGGTTCTAAAATAAAATGACTGG + Intergenic
1194147849 X:90284959-90284981 TAGTCCTAAAATAAAGTGACTGG + Intergenic
1194166813 X:90526567-90526589 TAGTATTAGAATAATATGACTGG + Intergenic
1194671803 X:96742617-96742639 TAGAGCTACAATAAAATAAAAGG - Intronic
1194849720 X:98856057-98856079 TAGAGCAAGAATAAAAGGAAGGG - Intergenic
1194886884 X:99326905-99326927 TAGAGCTAGAATGAAATGACTGG + Intergenic
1195150463 X:102063591-102063613 CAGTCCTAAAATAAAATGACTGG + Intergenic
1195447803 X:104973815-104973837 TTGTCCTAGATTAAAATGATTGG - Intronic
1196088828 X:111716708-111716730 TAGACCTGGGATCAAATAACTGG + Intronic
1196432044 X:115637378-115637400 TAAAGGTAGGATAAAATGACAGG - Intronic
1196543484 X:116936573-116936595 TTGTCCTAGAATAAAATAACTGG - Intergenic
1196627279 X:117890868-117890890 GGGACCCAGAATAAAATGTCTGG - Intergenic
1196884619 X:120231583-120231605 TTCTCCTAGAATAAAATGACTGG + Intergenic
1197442308 X:126507541-126507563 GAGACTTAGAATAAAGTGGCTGG - Intergenic
1198844698 X:140898459-140898481 TTGTCCTAAAGTAAAATGACTGG - Intergenic
1198927843 X:141819752-141819774 TTGTCCTAGAGTAAAATAACCGG - Intergenic
1198952310 X:142085311-142085333 TTGTCCTAAAAGAAAATGACTGG + Intergenic
1199216382 X:145264182-145264204 TTGCCCTAGAGTAAAATGACTGG - Intergenic
1199355913 X:146863816-146863838 TTTTCCTAGAATACAATGACTGG - Intergenic
1199366926 X:146997993-146998015 TTGCCCTAAAATAAAATGACTGG + Intergenic
1199398940 X:147374679-147374701 TAGACATAGAATCAAAAGAATGG - Intergenic
1199644662 X:149894960-149894982 TTGCCCTAAAATAAAATGACTGG - Intergenic
1199869323 X:151883117-151883139 TAGTCCTAGAGTGAAATGAATGG + Intergenic
1199887671 X:152037457-152037479 TAGTACTAGAATAAAATGGCTGG - Intergenic
1200494233 Y:3861720-3861742 TAGTCCTAAAATAAAGTGACTGG + Intergenic
1200513079 Y:4104348-4104370 TAGTATTAGAATAATATGACTGG + Intergenic
1201319692 Y:12684492-12684514 TAGTCCTAAAATAAAATGACTGG + Intergenic
1201408131 Y:13669797-13669819 TTGCACTAAAATAAAATGACTGG - Intergenic