ID: 935153762

View in Genome Browser
Species Human (GRCh38)
Location 2:100463867-100463889
Sequence AGTTATGTATGTACAGATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935153762_935153764 30 Left 935153762 2:100463867-100463889 CCTACATCTGTACATACATAACT No data
Right 935153764 2:100463920-100463942 AAGTTGGTAGATTGCAAAATTGG No data
935153762_935153763 14 Left 935153762 2:100463867-100463889 CCTACATCTGTACATACATAACT No data
Right 935153763 2:100463904-100463926 TTTAAAACTTTTACATAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935153762 Original CRISPR AGTTATGTATGTACAGATGT AGG (reversed) Intergenic
No off target data available for this crispr