ID: 935153764

View in Genome Browser
Species Human (GRCh38)
Location 2:100463920-100463942
Sequence AAGTTGGTAGATTGCAAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935153762_935153764 30 Left 935153762 2:100463867-100463889 CCTACATCTGTACATACATAACT No data
Right 935153764 2:100463920-100463942 AAGTTGGTAGATTGCAAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935153764 Original CRISPR AAGTTGGTAGATTGCAAAAT TGG Intergenic
No off target data available for this crispr