ID: 935154262

View in Genome Browser
Species Human (GRCh38)
Location 2:100468934-100468956
Sequence TTAAGTGGGAGTTGCTCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 151}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935154262_935154265 29 Left 935154262 2:100468934-100468956 CCTTCTGAGCAACTCCCACTTAA 0: 1
1: 0
2: 2
3: 10
4: 151
Right 935154265 2:100468986-100469008 ACAATTATATATTATGACTTAGG 0: 1
1: 0
2: 0
3: 32
4: 378

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935154262 Original CRISPR TTAAGTGGGAGTTGCTCAGA AGG (reversed) Intergenic
900482835 1:2907666-2907688 TTAAATGCCAGATGCTCAGAGGG + Intergenic
901850552 1:12012203-12012225 AGGAGTGGGAGTAGCTCAGAGGG + Exonic
905155935 1:35981768-35981790 TTAAATGGGGGATTCTCAGAAGG - Intronic
907949531 1:59168905-59168927 TTAAGTGGGAGTTGAACAATGGG + Intergenic
908067493 1:60423139-60423161 ATAAATAGGAATTGCTCAGAAGG - Intergenic
912774683 1:112498119-112498141 ATAAGTGGGAGTTGGACACAAGG - Intronic
912981737 1:114380108-114380130 GTGAGTGGGAGTTCCACAGAGGG - Intergenic
913685679 1:121229728-121229750 TTAGATGGGAGTTGCTGAGGTGG + Intronic
914037526 1:144017331-144017353 TTAGATGGGAGTTGCTGAGGTGG + Intergenic
914151928 1:145050601-145050623 TTAGATGGGAGTTGCTGAGGTGG - Intronic
915466413 1:156100959-156100981 ATGAGTAGGAGTTGATCAGAGGG + Intronic
916705476 1:167344993-167345015 ATAAGTGGGAGTTGAACAGTGGG + Intronic
918262117 1:182805759-182805781 ATAAGTGGGAGTTACTCATGCGG - Intronic
920473000 1:206248285-206248307 TTAGATGGGAGTTGCTGAGGTGG + Intronic
922006611 1:221537274-221537296 CTAAGTGGGAGTTGGTCAGATGG + Intergenic
922716596 1:227878076-227878098 ATAAGTGGGAGTTGAACACATGG + Intergenic
922880050 1:228974090-228974112 TGCACTGGGAGTTGCTCAGAGGG - Intergenic
924515058 1:244759112-244759134 TTAAGTGTGAATTGCTCACCTGG + Intergenic
1062863401 10:828275-828297 TTAAGTATGAGTTTTTCAGAAGG - Intronic
1063506997 10:6608586-6608608 GTAAGTGGGAGTTAACCAGATGG + Intergenic
1067181431 10:43988998-43989020 ATAAGTGGGGGTTGGTCACATGG + Intergenic
1067204752 10:44203058-44203080 TTATCTGGGTGTTGCTGAGAGGG + Intergenic
1068398433 10:56495171-56495193 ATAAGTGGGAGTTGAACAGTGGG + Intergenic
1068873815 10:61975396-61975418 GAAAGTGGGAGTAGCTCAGTGGG + Intronic
1072056609 10:91764739-91764761 CTAAGTGGGAGTTAAACAGAAGG + Intergenic
1072977002 10:100067536-100067558 TTAATTGGGAGTTTCCCAAATGG - Intronic
1073804311 10:107079895-107079917 TTAGGTGGGAGCTGCTCATGAGG - Intronic
1075906300 10:126084685-126084707 TTCAGTGTCAGTTGCTCAGTGGG - Intronic
1077971296 11:7193914-7193936 ATAAGTGGGAGTTGAACACATGG + Intergenic
1080134100 11:28833898-28833920 ATAAGTGAAAGTTGCTCAGAAGG + Intergenic
1080577730 11:33615207-33615229 TAAAGATGGAGTTGCTCTGATGG + Intronic
1085253984 11:75162004-75162026 TTAAGTGAGACGAGCTCAGAGGG + Intronic
1090699749 11:129282876-129282898 TTAAGTGGGAGATATTCAAATGG - Intergenic
1091959298 12:4678074-4678096 ATAAGTGGGAGTTGAACACATGG + Intronic
1092466779 12:8740407-8740429 TTTAGTGGTGGTTTCTCAGATGG + Intronic
1092680046 12:10968896-10968918 TTAAGTGTTAGTAGCTCAGTGGG + Intronic
1093187682 12:16040288-16040310 TTAAGTGTGAATTGACCAGATGG - Intergenic
1100333944 12:93612092-93612114 TGAAGTAGGTGTTGCTCACAGGG - Intergenic
1100522955 12:95393735-95393757 CTATCTGGAAGTTGCTCAGAAGG + Intergenic
1103462547 12:121116626-121116648 TTGAGTTGGAGTTGCTAAGCTGG - Intergenic
1104061887 12:125275614-125275636 GTGAGTGGGAGTTGAACAGATGG + Intronic
1106709371 13:32314394-32314416 TTCAGTGAGAGTTGCTCCCATGG - Exonic
1109705923 13:66092668-66092690 TTAAGTGTGAATAGCTCAGTGGG - Intergenic
1114833852 14:26179599-26179621 TTATGTGGGATCTGTTCAGAGGG - Intergenic
1116489544 14:45490000-45490022 ATAAGTGGGAGCTGATCACATGG + Intergenic
1117439851 14:55749316-55749338 TTAAGCTGGAGTTGCTCCCAGGG - Intergenic
1119907406 14:78318335-78318357 TTAAGTGGAAACTGCTCTGATGG + Intronic
1124163025 15:27291997-27292019 ATAAGTGGGAGTTGAACAGTGGG - Intronic
1128353843 15:66910524-66910546 TTTAGTGGTAGTTGCTAAGTGGG - Intergenic
1133539382 16:6734222-6734244 TTCAATGGGAGTTGGACAGAGGG - Intronic
1137860404 16:51841200-51841222 CTAAGTGGGATTTGGTGAGATGG - Intergenic
1138827672 16:60340472-60340494 TTGAGTGGGAATTGGCCAGATGG + Intergenic
1144126639 17:12208899-12208921 GTCAGTGGGAGTTTTTCAGAAGG - Intergenic
1145841967 17:28002669-28002691 TAAGGTGGCAGTTGCTGAGAAGG + Intergenic
1145982000 17:29018443-29018465 TAAAGGGGGAGTTGGTCAGATGG + Intronic
1147222980 17:38950635-38950657 TATTGTGGGAGTTTCTCAGAGGG + Intronic
1147370381 17:39988637-39988659 TCAAGTGGCAGTTCCTCAAAAGG - Intronic
1147575683 17:41598016-41598038 TGAAGGGGGTGTTGCTCATATGG - Intergenic
1156572167 18:38268612-38268634 TTAAGTGGGAGTTGAACAATGGG + Intergenic
1158236006 18:55314848-55314870 TTAAGTGGGAATTGCTATGTTGG - Intronic
1158354219 18:56598433-56598455 ATAAGTAGGAATTGGTCAGATGG + Exonic
1160255606 18:77246134-77246156 TTGAATGGGAGTTGGCCAGATGG - Intergenic
1162327391 19:10007219-10007241 GTCAGAGGGAGTTGATCAGAAGG - Intronic
1162801867 19:13115810-13115832 TTAAGGGGAGGTTTCTCAGAGGG - Intronic
1163643108 19:18473067-18473089 ATCAGTAGGAGTTCCTCAGATGG + Intronic
1166325155 19:42045306-42045328 TTAAATGGGGGCTGCTCTGAAGG - Intronic
1166631240 19:44409894-44409916 TTAAGTCTGAGTTTCTGAGAGGG - Intergenic
1166632120 19:44416009-44416031 TTAAGTCTGAGTTTCTGAGAGGG - Intergenic
926678248 2:15644774-15644796 TGAAGCAGGAATTGCTCAGAGGG - Intergenic
929305430 2:40355895-40355917 TTAAGTGGGATTTGCTGGAAAGG + Intronic
929930684 2:46253448-46253470 TTCAGAGGGAGTGGCTCAGAAGG - Intergenic
932179421 2:69632522-69632544 GTAGTTGGGAGTTGCTCAGAAGG + Intronic
932787521 2:74620438-74620460 TTAGGTGGGGGTTGTTCAGCAGG - Intronic
935154262 2:100468934-100468956 TTAAGTGGGAGTTGCTCAGAAGG - Intergenic
935434831 2:103018962-103018984 GTACCTGGGAGTTACTCAGAAGG + Intergenic
936234178 2:110729484-110729506 TCAGATGGGGGTTGCTCAGATGG + Intergenic
936992705 2:118383066-118383088 GTAAGAGGGTGGTGCTCAGAAGG + Intergenic
937492166 2:122381389-122381411 TTAAGAGGAAGTTTCTCAGAGGG + Intergenic
937898513 2:126997340-126997362 ATAAGTGGGAGTTGAACAGCGGG + Intergenic
938540908 2:132282700-132282722 TTAAGTCTGAGTTTCTGAGAGGG + Intergenic
939837328 2:147146876-147146898 ATAAGTGGGAGTTGAACAGTGGG - Intergenic
942081203 2:172401175-172401197 CTCAGTGGGAGTTGCTAAGCAGG - Intergenic
942957801 2:181794552-181794574 TTAAGTGGGAGCTGTGCATAGGG + Intergenic
943094678 2:183414975-183414997 ATAAGTGGAACTTTCTCAGATGG - Intergenic
946231478 2:218294013-218294035 TTAAGTAGGAGTTACTTAGGGGG + Intronic
1169260391 20:4134269-4134291 TTAAGTTTGAGGTGCTCAGGAGG + Intronic
1171869816 20:30515701-30515723 TTAAGTCTGAGTTTCTGAGAGGG + Intergenic
1171870604 20:30521479-30521501 TTAAGTCTGAGTTTCTGAGAGGG + Intergenic
1173106848 20:40144871-40144893 TTCACTGGGAGTTGATTAGAGGG - Intergenic
1176611786 21:8990658-8990680 TTAAGTCTGAGTTACTGAGAGGG - Intergenic
1177329621 21:19640957-19640979 ATAAGTGGGAGTTGATCAATGGG - Intergenic
1178233677 21:30817570-30817592 TTGCATGGGAGTTGATCAGAAGG - Intergenic
1180215709 21:46322827-46322849 TTAAGTTGCAGTTGCTGAGGAGG + Exonic
949952393 3:9240007-9240029 TTAAGTGTGAATCGCTCAGTAGG - Intronic
950759358 3:15206617-15206639 TTCGGTCGGAGTTGCTCAGTCGG + Intronic
951583491 3:24190802-24190824 TTAAGTGGGACGTGCTCACGTGG + Intronic
952276541 3:31882762-31882784 TGATGTGGGTGTTGCTCAGCAGG - Intronic
957964012 3:87298623-87298645 TAAAGTGGCATTTGCTTAGAAGG + Intergenic
958751741 3:98200247-98200269 TTAAGTGGGAGTTGAACAATGGG + Intergenic
959238687 3:103759492-103759514 ATAAGTGGGAGTTGAACAGTGGG + Intergenic
960163390 3:114374830-114374852 TTCTGTTGGAGGTGCTCAGAAGG - Intronic
960410055 3:117311953-117311975 ATAAGTGGGAGTAACTCACAGGG - Intergenic
961406713 3:126684911-126684933 TTAAGTGTCAGGTGCCCAGAAGG + Intergenic
961717895 3:128871227-128871249 ATAACAGGGAGTTGCACAGAAGG - Intergenic
962340925 3:134582389-134582411 TTGGGTGGGAGTTGAACAGAGGG - Intergenic
962506286 3:136049596-136049618 TTCAGTGGGAGTAGCCCTGAAGG - Intronic
963691732 3:148512463-148512485 TGAAGTCTGAGTTTCTCAGATGG - Intergenic
965420285 3:168449383-168449405 ATAAGTAGGAGTTCCTCAGGAGG - Intergenic
966901076 3:184485853-184485875 GTAATTGGGACTTGCTCAGTTGG - Intronic
969846861 4:9926135-9926157 TTAAGTGGCTCTTGCTCAGGGGG - Intronic
972302601 4:37799212-37799234 TCTAGTGGGAGATGCCCAGAAGG + Intergenic
973557095 4:52094573-52094595 GTAAGTGGGATTAGTTCAGATGG + Intronic
974413350 4:61570988-61571010 TTAATGGGGGGTTGCTCAAATGG + Intronic
974730883 4:65864477-65864499 ATAAGTGGGAGTTGAACACATGG + Intergenic
974793545 4:66719832-66719854 TTAAGTGGGAGTTGAACAATGGG + Intergenic
975080330 4:70270737-70270759 TTAACTGGGAGTTGCTTAGAAGG + Intergenic
975405472 4:73983281-73983303 TTAAGTGTCAGTTCCTCAGAGGG + Intergenic
982557628 4:156888388-156888410 TTAAATTGTAATTGCTCAGATGG - Intronic
984872398 4:184338111-184338133 TTATGTAGGAGTTGCTCAACAGG + Intergenic
985430157 4:189871475-189871497 TGAAGTGGGATTTGCTTAAATGG - Intergenic
987975682 5:25012084-25012106 ATAAGTGGGAGTTGAACACATGG + Intergenic
991632222 5:68667633-68667655 TTAAGTGAGATTTCCTCAGAAGG - Intergenic
993376908 5:87159338-87159360 TTAATTGGGAGTTTTTCAAAGGG - Intergenic
993835629 5:92816978-92817000 TTAAGTGTGAGTTGTCCATAGGG + Intergenic
994145989 5:96395573-96395595 ATAAGTGGGAGTTGAACAGTGGG + Intronic
999638294 5:153645287-153645309 TTCAGTGGGAGTAGGACAGATGG + Intronic
1000433109 5:161174627-161174649 TTTAGCTGGAGTTGCTCAGGAGG + Intergenic
1000661427 5:163943906-163943928 GAAACTGGGAGTTGCTCAGTAGG + Intergenic
1001566488 5:172702788-172702810 TGAAATGTGACTTGCTCAGAAGG + Intergenic
1002211804 5:177603934-177603956 TGAACTGGGAGTGGTTCAGAGGG + Intronic
1002516336 5:179761720-179761742 TTAAGTGGCAGATGATAAGAGGG + Intronic
1006523304 6:34584443-34584465 TTCAGTGTGAGATGCTCAGCAGG - Intergenic
1011321803 6:86103949-86103971 TTAAGTGACAGTTGTTTAGATGG + Intergenic
1015951888 6:138561597-138561619 CTCAGTGTGAGTTACTCAGAAGG + Intronic
1019926211 7:4194708-4194730 TTAAGTGGCAGCTGATGAGATGG + Intronic
1020980918 7:15067871-15067893 TAAAGTCTGAGTTTCTCAGAGGG + Intergenic
1024949925 7:54849907-54849929 ATAAGTGGGAGTTGCACAATGGG - Intergenic
1027751571 7:82154414-82154436 CTAAGTGGGAGTTGAACACATGG + Intronic
1028689294 7:93633608-93633630 TTAAGTGGCAGCTGCTCAAAAGG - Intronic
1029209965 7:98899334-98899356 TTCAGTGGGTGATGCTCAGTGGG + Intronic
1030377966 7:108775583-108775605 TCAAATGGGAGTTTCCCAGAAGG - Intergenic
1033267077 7:139895735-139895757 TGAAGTGGGAGGTGATCTGAGGG + Intronic
1036985078 8:13520404-13520426 ATAAGTGGGAGTTGAACAGTGGG + Intergenic
1039404925 8:37304262-37304284 ATCAGTGGAAGCTGCTCAGAAGG + Intergenic
1041897974 8:62948036-62948058 CTAAGCGGCAGTTGCTCATATGG - Intronic
1048317460 8:133372872-133372894 TCCAGTGAGAGTTGCCCAGAGGG - Intergenic
1048962573 8:139593111-139593133 CTAAGTGGGAGTTGGTCAGGTGG - Intergenic
1050098169 9:2089503-2089525 TTAAGTGGGAGTTTTCAAGATGG + Intronic
1051370533 9:16355332-16355354 TTAAGTGGGGCTTGCCCAGGAGG - Intergenic
1052068104 9:24048052-24048074 TTTAATGGGAGTTGCTAAGCTGG - Intergenic
1052829766 9:33205566-33205588 CTGAGTGGGAGTTGCGTAGAAGG - Intergenic
1053332145 9:37222043-37222065 GTAAGGGAGAGTTGATCAGATGG + Intronic
1055222550 9:73954474-73954496 CTAAGTGGGAGGTACTCAGTGGG - Intergenic
1057345679 9:94248487-94248509 TTAACTGGAAGTTGCTCCTAAGG + Intergenic
1059801976 9:117759106-117759128 TTAAGTGGGAGCTGAACACATGG - Intergenic
1203480594 Un_GL000224v1:6971-6993 TTAAGCCGGAGTTTCTGAGAGGG + Intergenic
1203373480 Un_KI270442v1:340302-340324 TTAAGAAGAAGTTTCTCAGAAGG - Intergenic
1203568657 Un_KI270744v1:111799-111821 TTAAGTCTGAGTTTCTGAGAGGG + Intergenic
1186082019 X:5943409-5943431 TGAAGTGTGAGTAGCTCGGATGG - Intronic
1194606697 X:95988329-95988351 TTCAGTGGGAGTTGCACAAGTGG + Intergenic
1198773142 X:140151676-140151698 ATAAGTGGGAGTTGAACACATGG - Intergenic
1200024362 X:153243607-153243629 TTCTGTTGGAGGTGCTCAGAAGG - Intergenic
1200694289 Y:6344674-6344696 TTAAATGACAGTTGCTTAGAAGG - Intergenic
1201040988 Y:9830042-9830064 TTAAATGACAGTTGCTTAGAAGG + Intergenic