ID: 935156277

View in Genome Browser
Species Human (GRCh38)
Location 2:100486363-100486385
Sequence CTCCATAGGATAATCTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935156277_935156284 14 Left 935156277 2:100486363-100486385 CCTCCCAAGATTATCCTATGGAG No data
Right 935156284 2:100486400-100486422 GATGTGTGTTCAATGCAAGGAGG No data
935156277_935156285 15 Left 935156277 2:100486363-100486385 CCTCCCAAGATTATCCTATGGAG No data
Right 935156285 2:100486401-100486423 ATGTGTGTTCAATGCAAGGAGGG No data
935156277_935156283 11 Left 935156277 2:100486363-100486385 CCTCCCAAGATTATCCTATGGAG No data
Right 935156283 2:100486397-100486419 GAAGATGTGTGTTCAATGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935156277 Original CRISPR CTCCATAGGATAATCTTGGG AGG (reversed) Intergenic
No off target data available for this crispr