ID: 935156284

View in Genome Browser
Species Human (GRCh38)
Location 2:100486400-100486422
Sequence GATGTGTGTTCAATGCAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935156282_935156284 0 Left 935156282 2:100486377-100486399 CCTATGGAGGAGATGAGGCAGAA No data
Right 935156284 2:100486400-100486422 GATGTGTGTTCAATGCAAGGAGG No data
935156279_935156284 11 Left 935156279 2:100486366-100486388 CCCAAGATTATCCTATGGAGGAG No data
Right 935156284 2:100486400-100486422 GATGTGTGTTCAATGCAAGGAGG No data
935156277_935156284 14 Left 935156277 2:100486363-100486385 CCTCCCAAGATTATCCTATGGAG No data
Right 935156284 2:100486400-100486422 GATGTGTGTTCAATGCAAGGAGG No data
935156280_935156284 10 Left 935156280 2:100486367-100486389 CCAAGATTATCCTATGGAGGAGA No data
Right 935156284 2:100486400-100486422 GATGTGTGTTCAATGCAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935156284 Original CRISPR GATGTGTGTTCAATGCAAGG AGG Intergenic
No off target data available for this crispr