ID: 935156935

View in Genome Browser
Species Human (GRCh38)
Location 2:100491709-100491731
Sequence TGGTCTGACCAGAGGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935156931_935156935 -7 Left 935156931 2:100491693-100491715 CCAGGGACAAGTATACTGGTCTG No data
Right 935156935 2:100491709-100491731 TGGTCTGACCAGAGGGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935156935 Original CRISPR TGGTCTGACCAGAGGGCAGA GGG Intergenic
No off target data available for this crispr