ID: 935157970

View in Genome Browser
Species Human (GRCh38)
Location 2:100500703-100500725
Sequence AATGGTAGTGTGAGGTAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935157965_935157970 -3 Left 935157965 2:100500683-100500705 CCTCAGGGAAGGACCTCCAGAAT No data
Right 935157970 2:100500703-100500725 AATGGTAGTGTGAGGTAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935157970 Original CRISPR AATGGTAGTGTGAGGTAACC AGG Intergenic