ID: 935162323

View in Genome Browser
Species Human (GRCh38)
Location 2:100539998-100540020
Sequence CAAACCATTGTGCAGTTATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935162323_935162324 -9 Left 935162323 2:100539998-100540020 CCAGATAACTGCACAATGGTTTG No data
Right 935162324 2:100540012-100540034 AATGGTTTGCAGCAGAAGAAAGG No data
935162323_935162326 10 Left 935162323 2:100539998-100540020 CCAGATAACTGCACAATGGTTTG No data
Right 935162326 2:100540031-100540053 AAGGAAGATATTTATTTGCAGGG No data
935162323_935162325 9 Left 935162323 2:100539998-100540020 CCAGATAACTGCACAATGGTTTG No data
Right 935162325 2:100540030-100540052 AAAGGAAGATATTTATTTGCAGG No data
935162323_935162327 25 Left 935162323 2:100539998-100540020 CCAGATAACTGCACAATGGTTTG No data
Right 935162327 2:100540046-100540068 TTGCAGGGCACCATGCAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935162323 Original CRISPR CAAACCATTGTGCAGTTATC TGG (reversed) Intergenic
No off target data available for this crispr