ID: 935167311

View in Genome Browser
Species Human (GRCh38)
Location 2:100580726-100580748
Sequence CATTGCCACTGGAGTAGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935167311_935167327 24 Left 935167311 2:100580726-100580748 CCCCCTCTACTCCAGTGGCAATG No data
Right 935167327 2:100580773-100580795 GGCCTCTCTTGAGCTGTGGGTGG No data
935167311_935167325 21 Left 935167311 2:100580726-100580748 CCCCCTCTACTCCAGTGGCAATG No data
Right 935167325 2:100580770-100580792 CCCGGCCTCTCTTGAGCTGTGGG No data
935167311_935167329 28 Left 935167311 2:100580726-100580748 CCCCCTCTACTCCAGTGGCAATG No data
Right 935167329 2:100580777-100580799 TCTCTTGAGCTGTGGGTGGTTGG No data
935167311_935167323 20 Left 935167311 2:100580726-100580748 CCCCCTCTACTCCAGTGGCAATG No data
Right 935167323 2:100580769-100580791 CCCCGGCCTCTCTTGAGCTGTGG No data
935167311_935167320 3 Left 935167311 2:100580726-100580748 CCCCCTCTACTCCAGTGGCAATG No data
Right 935167320 2:100580752-100580774 CCCGCTGGAAGAGTAAACCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935167311 Original CRISPR CATTGCCACTGGAGTAGAGG GGG (reversed) Intergenic
No off target data available for this crispr