ID: 935167320

View in Genome Browser
Species Human (GRCh38)
Location 2:100580752-100580774
Sequence CCCGCTGGAAGAGTAAACCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935167314_935167320 1 Left 935167314 2:100580728-100580750 CCCTCTACTCCAGTGGCAATGGG No data
Right 935167320 2:100580752-100580774 CCCGCTGGAAGAGTAAACCCCGG No data
935167317_935167320 -8 Left 935167317 2:100580737-100580759 CCAGTGGCAATGGGACCCGCTGG No data
Right 935167320 2:100580752-100580774 CCCGCTGGAAGAGTAAACCCCGG No data
935167306_935167320 24 Left 935167306 2:100580705-100580727 CCCACCAGTATCCAGGATTCTCC No data
Right 935167320 2:100580752-100580774 CCCGCTGGAAGAGTAAACCCCGG No data
935167311_935167320 3 Left 935167311 2:100580726-100580748 CCCCCTCTACTCCAGTGGCAATG No data
Right 935167320 2:100580752-100580774 CCCGCTGGAAGAGTAAACCCCGG No data
935167312_935167320 2 Left 935167312 2:100580727-100580749 CCCCTCTACTCCAGTGGCAATGG No data
Right 935167320 2:100580752-100580774 CCCGCTGGAAGAGTAAACCCCGG No data
935167309_935167320 13 Left 935167309 2:100580716-100580738 CCAGGATTCTCCCCCTCTACTCC No data
Right 935167320 2:100580752-100580774 CCCGCTGGAAGAGTAAACCCCGG No data
935167308_935167320 20 Left 935167308 2:100580709-100580731 CCAGTATCCAGGATTCTCCCCCT No data
Right 935167320 2:100580752-100580774 CCCGCTGGAAGAGTAAACCCCGG No data
935167307_935167320 23 Left 935167307 2:100580706-100580728 CCACCAGTATCCAGGATTCTCCC No data
Right 935167320 2:100580752-100580774 CCCGCTGGAAGAGTAAACCCCGG No data
935167316_935167320 0 Left 935167316 2:100580729-100580751 CCTCTACTCCAGTGGCAATGGGA No data
Right 935167320 2:100580752-100580774 CCCGCTGGAAGAGTAAACCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935167320 Original CRISPR CCCGCTGGAAGAGTAAACCC CGG Intergenic
No off target data available for this crispr