ID: 935167325

View in Genome Browser
Species Human (GRCh38)
Location 2:100580770-100580792
Sequence CCCGGCCTCTCTTGAGCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935167311_935167325 21 Left 935167311 2:100580726-100580748 CCCCCTCTACTCCAGTGGCAATG No data
Right 935167325 2:100580770-100580792 CCCGGCCTCTCTTGAGCTGTGGG No data
935167319_935167325 -5 Left 935167319 2:100580752-100580774 CCCGCTGGAAGAGTAAACCCCGG No data
Right 935167325 2:100580770-100580792 CCCGGCCTCTCTTGAGCTGTGGG No data
935167317_935167325 10 Left 935167317 2:100580737-100580759 CCAGTGGCAATGGGACCCGCTGG No data
Right 935167325 2:100580770-100580792 CCCGGCCTCTCTTGAGCTGTGGG No data
935167316_935167325 18 Left 935167316 2:100580729-100580751 CCTCTACTCCAGTGGCAATGGGA No data
Right 935167325 2:100580770-100580792 CCCGGCCTCTCTTGAGCTGTGGG No data
935167321_935167325 -6 Left 935167321 2:100580753-100580775 CCGCTGGAAGAGTAAACCCCGGC No data
Right 935167325 2:100580770-100580792 CCCGGCCTCTCTTGAGCTGTGGG No data
935167314_935167325 19 Left 935167314 2:100580728-100580750 CCCTCTACTCCAGTGGCAATGGG No data
Right 935167325 2:100580770-100580792 CCCGGCCTCTCTTGAGCTGTGGG No data
935167312_935167325 20 Left 935167312 2:100580727-100580749 CCCCTCTACTCCAGTGGCAATGG No data
Right 935167325 2:100580770-100580792 CCCGGCCTCTCTTGAGCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935167325 Original CRISPR CCCGGCCTCTCTTGAGCTGT GGG Intergenic
No off target data available for this crispr