ID: 935167556

View in Genome Browser
Species Human (GRCh38)
Location 2:100582446-100582468
Sequence CCGCACCCGGCCTTTTTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935167556_935167562 7 Left 935167556 2:100582446-100582468 CCCCAAAAAAAGGCCGGGTGCGG No data
Right 935167562 2:100582476-100582498 CGCCTGTAATCCCAGCACTTTGG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
935167556_935167571 24 Left 935167556 2:100582446-100582468 CCCCAAAAAAAGGCCGGGTGCGG No data
Right 935167571 2:100582493-100582515 CTTTGGGAGGCCAAGGCGGGTGG 0: 17665
1: 104567
2: 162703
3: 161462
4: 107266
935167556_935167563 8 Left 935167556 2:100582446-100582468 CCCCAAAAAAAGGCCGGGTGCGG No data
Right 935167563 2:100582477-100582499 GCCTGTAATCCCAGCACTTTGGG 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
935167556_935167569 20 Left 935167556 2:100582446-100582468 CCCCAAAAAAAGGCCGGGTGCGG No data
Right 935167569 2:100582489-100582511 AGCACTTTGGGAGGCCAAGGCGG 0: 55360
1: 145174
2: 158991
3: 100124
4: 51656
935167556_935167565 11 Left 935167556 2:100582446-100582468 CCCCAAAAAAAGGCCGGGTGCGG No data
Right 935167565 2:100582480-100582502 TGTAATCCCAGCACTTTGGGAGG 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
935167556_935167567 17 Left 935167556 2:100582446-100582468 CCCCAAAAAAAGGCCGGGTGCGG No data
Right 935167567 2:100582486-100582508 CCCAGCACTTTGGGAGGCCAAGG 0: 79234
1: 201556
2: 232767
3: 156913
4: 93134
935167556_935167570 21 Left 935167556 2:100582446-100582468 CCCCAAAAAAAGGCCGGGTGCGG No data
Right 935167570 2:100582490-100582512 GCACTTTGGGAGGCCAAGGCGGG 0: 56485
1: 171609
2: 226607
3: 184242
4: 115036

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935167556 Original CRISPR CCGCACCCGGCCTTTTTTTG GGG (reversed) Intergenic
No off target data available for this crispr