ID: 935171571

View in Genome Browser
Species Human (GRCh38)
Location 2:100614532-100614554
Sequence CCTGCTAAGAATCTATTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935171571_935171573 -9 Left 935171571 2:100614532-100614554 CCTTGCAATAGATTCTTAGCAGG No data
Right 935171573 2:100614546-100614568 CTTAGCAGGCCACACAGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935171571 Original CRISPR CCTGCTAAGAATCTATTGCA AGG (reversed) Intergenic
No off target data available for this crispr