ID: 935176363

View in Genome Browser
Species Human (GRCh38)
Location 2:100652873-100652895
Sequence CTGGTTAAAACTGCTGTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935176363_935176365 6 Left 935176363 2:100652873-100652895 CCTGCAACAGCAGTTTTAACCAG No data
Right 935176365 2:100652902-100652924 ACTTTATTTCGTTTTTGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935176363 Original CRISPR CTGGTTAAAACTGCTGTTGC AGG (reversed) Intergenic
No off target data available for this crispr