ID: 935180781

View in Genome Browser
Species Human (GRCh38)
Location 2:100689463-100689485
Sequence GGGCTGAGAGGAGCTCAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935180772_935180781 28 Left 935180772 2:100689412-100689434 CCTCTGCTGGAACAGCAGGGAGG No data
Right 935180781 2:100689463-100689485 GGGCTGAGAGGAGCTCAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935180781 Original CRISPR GGGCTGAGAGGAGCTCAAGA GGG Intergenic
No off target data available for this crispr