ID: 935182198

View in Genome Browser
Species Human (GRCh38)
Location 2:100701247-100701269
Sequence CACTGGCCTCCCCTAAAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935182192_935182198 11 Left 935182192 2:100701213-100701235 CCCTACTTGGCTCTGGCTCACTC No data
Right 935182198 2:100701247-100701269 CACTGGCCTCCCCTAAAGGGTGG No data
935182188_935182198 29 Left 935182188 2:100701195-100701217 CCACTCATTAACCAGCTTCCCTA No data
Right 935182198 2:100701247-100701269 CACTGGCCTCCCCTAAAGGGTGG No data
935182190_935182198 18 Left 935182190 2:100701206-100701228 CCAGCTTCCCTACTTGGCTCTGG No data
Right 935182198 2:100701247-100701269 CACTGGCCTCCCCTAAAGGGTGG No data
935182187_935182198 30 Left 935182187 2:100701194-100701216 CCCACTCATTAACCAGCTTCCCT No data
Right 935182198 2:100701247-100701269 CACTGGCCTCCCCTAAAGGGTGG No data
935182193_935182198 10 Left 935182193 2:100701214-100701236 CCTACTTGGCTCTGGCTCACTCC No data
Right 935182198 2:100701247-100701269 CACTGGCCTCCCCTAAAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935182198 Original CRISPR CACTGGCCTCCCCTAAAGGG TGG Intergenic
No off target data available for this crispr