ID: 935183932

View in Genome Browser
Species Human (GRCh38)
Location 2:100714870-100714892
Sequence AGTTATTTTCAGAAGATGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935183932_935183937 16 Left 935183932 2:100714870-100714892 CCTACCATCTTCTGAAAATAACT No data
Right 935183937 2:100714909-100714931 ACAGCTCTTGGCCTGTTACTGGG 0: 174
1: 194
2: 145
3: 123
4: 215
935183932_935183939 25 Left 935183932 2:100714870-100714892 CCTACCATCTTCTGAAAATAACT No data
Right 935183939 2:100714918-100714940 GGCCTGTTACTGGGCTTTGGTGG 0: 144
1: 161
2: 86
3: 68
4: 218
935183932_935183934 4 Left 935183932 2:100714870-100714892 CCTACCATCTTCTGAAAATAACT No data
Right 935183934 2:100714897-100714919 TCCTTTTGACAGACAGCTCTTGG No data
935183932_935183938 22 Left 935183932 2:100714870-100714892 CCTACCATCTTCTGAAAATAACT No data
Right 935183938 2:100714915-100714937 CTTGGCCTGTTACTGGGCTTTGG 0: 169
1: 171
2: 103
3: 76
4: 232
935183932_935183936 15 Left 935183932 2:100714870-100714892 CCTACCATCTTCTGAAAATAACT No data
Right 935183936 2:100714908-100714930 GACAGCTCTTGGCCTGTTACTGG 0: 162
1: 189
2: 129
3: 114
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935183932 Original CRISPR AGTTATTTTCAGAAGATGGT AGG (reversed) Intergenic
No off target data available for this crispr