ID: 935183934

View in Genome Browser
Species Human (GRCh38)
Location 2:100714897-100714919
Sequence TCCTTTTGACAGACAGCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935183931_935183934 5 Left 935183931 2:100714869-100714891 CCCTACCATCTTCTGAAAATAAC No data
Right 935183934 2:100714897-100714919 TCCTTTTGACAGACAGCTCTTGG No data
935183933_935183934 0 Left 935183933 2:100714874-100714896 CCATCTTCTGAAAATAACTACTC No data
Right 935183934 2:100714897-100714919 TCCTTTTGACAGACAGCTCTTGG No data
935183930_935183934 27 Left 935183930 2:100714847-100714869 CCTGTAGGATTTTGGAGCAAGGC No data
Right 935183934 2:100714897-100714919 TCCTTTTGACAGACAGCTCTTGG No data
935183932_935183934 4 Left 935183932 2:100714870-100714892 CCTACCATCTTCTGAAAATAACT No data
Right 935183934 2:100714897-100714919 TCCTTTTGACAGACAGCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935183934 Original CRISPR TCCTTTTGACAGACAGCTCT TGG Intergenic
No off target data available for this crispr