ID: 935183938

View in Genome Browser
Species Human (GRCh38)
Location 2:100714915-100714937
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 751
Summary {0: 169, 1: 171, 2: 103, 3: 76, 4: 232}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935183933_935183938 18 Left 935183933 2:100714874-100714896 CCATCTTCTGAAAATAACTACTC No data
Right 935183938 2:100714915-100714937 CTTGGCCTGTTACTGGGCTTTGG 0: 169
1: 171
2: 103
3: 76
4: 232
935183932_935183938 22 Left 935183932 2:100714870-100714892 CCTACCATCTTCTGAAAATAACT No data
Right 935183938 2:100714915-100714937 CTTGGCCTGTTACTGGGCTTTGG 0: 169
1: 171
2: 103
3: 76
4: 232
935183935_935183938 -6 Left 935183935 2:100714898-100714920 CCTTTTGACAGACAGCTCTTGGC No data
Right 935183938 2:100714915-100714937 CTTGGCCTGTTACTGGGCTTTGG 0: 169
1: 171
2: 103
3: 76
4: 232
935183931_935183938 23 Left 935183931 2:100714869-100714891 CCCTACCATCTTCTGAAAATAAC No data
Right 935183938 2:100714915-100714937 CTTGGCCTGTTACTGGGCTTTGG 0: 169
1: 171
2: 103
3: 76
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900434963 1:2625619-2625641 CTTGGCCCGTTACTGGGCTTTGG + Intronic
901332738 1:8423641-8423663 CGTCGCCTGTCACTGGGCTCCGG + Intronic
901904046 1:12392641-12392663 CTTGGCCTGTTACTGGGCTTTGG - Intronic
904094110 1:27964555-27964577 CTGTGCCTGTTACTGTGCTGGGG + Intronic
904179489 1:28655928-28655950 CTTGGCCTATTACTGGGCTTTGG - Intergenic
904254875 1:29248458-29248480 CTGGGCATGTACCTGGGCTTGGG + Intronic
904335937 1:29798029-29798051 CTTGGCCTATTACTGGGCTTTGG + Intergenic
904419574 1:30383006-30383028 CCTGGCTTGCTACTGGGCTTTGG - Intergenic
904823847 1:33262073-33262095 CTGGGGCTGGAACTGGGCTTTGG + Intronic
905354070 1:37368826-37368848 CTTGGCCTGTTACTTGGCTTTGG + Intergenic
905366036 1:37452106-37452128 CTTGGCCTGAGAGTGGGCTAGGG - Intergenic
905465229 1:38148142-38148164 CTTAGCCTGTTACTGGGCTTTGG + Intergenic
905932570 1:41800004-41800026 AATGGCCTCTTCCTGGGCTTTGG + Intronic
906050493 1:42867457-42867479 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
906060905 1:42948054-42948076 CTTGGCCAGCAACTGGGCTCAGG + Intronic
906538324 1:46564821-46564843 CTTGGACTGTTAGTTGGGTTGGG - Intronic
906825118 1:48971121-48971143 CTTGGACAGGTACTGGGCTGTGG + Intronic
906879679 1:49576506-49576528 TTTGGCTTGTTACTGGGCTTTGG + Intronic
907597346 1:55732173-55732195 CTTAGACTGTTACTGAACTTTGG + Intergenic
907780346 1:57560877-57560899 CTTGGCCTGTTACTGGGCTTTGG + Intronic
908052315 1:60246756-60246778 TTCGGCCTGTTGCTGGGCTTTGG + Intergenic
909172603 1:72315423-72315445 CTTGTCCTCTTACTGGGCTTTGG - Intergenic
909548944 1:76877140-76877162 CTTTTGCTGTTACTGGGCTTTGG - Intronic
909576925 1:77185901-77185923 CTTGGCCTGTTACTGGGCTTTGG + Intronic
909810958 1:79931380-79931402 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
910370639 1:86512171-86512193 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
910630226 1:89346295-89346317 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
910638987 1:89439931-89439953 CTTGGCCTGTTACTGGACTTTGG - Intergenic
910790326 1:91043763-91043785 GTTGGCCTGTTACTGGGCTTTGG + Intergenic
910831093 1:91463381-91463403 CTTGGCCTGTTATTGGGCTTTGG - Intergenic
910948218 1:92616731-92616753 GTTGGCCTGTTACTGGACTTTGG + Intronic
911109093 1:94164162-94164184 CTTGGCCTGTTACTGGGCTTTGG - Intronic
911257320 1:95647321-95647343 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
911738393 1:101361876-101361898 CTTGGCCTGTTACTGGGCTTCGG - Intergenic
911883576 1:103270492-103270514 CTTGGCCTTCTACTCAGCTTTGG + Intergenic
911980430 1:104559464-104559486 CTTGGCCTGTTACTAGGCTTTGG + Intergenic
911981895 1:104579219-104579241 CTTGGCCTGTTATTGGGCTTTGG - Intergenic
912212257 1:107568937-107568959 CTTGGATTGCTACTGGGCTTTGG + Intergenic
912252024 1:108021345-108021367 CTTGGGTTGTTACTGGGCTTTGG - Intergenic
912733318 1:112128786-112128808 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
912943808 1:114068161-114068183 TTTAGCCTGTTACTGGGCTTTGG - Intergenic
913039442 1:115008352-115008374 CTTGTCCTGTTACTGGGATTTGG - Intergenic
914927936 1:151905554-151905576 CTTTGCCTGTTACTGCCTTTGGG - Intronic
916106325 1:161435284-161435306 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
916285321 1:163099571-163099593 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
917217209 1:172690870-172690892 CTTGGTCTGTTACTGGGCTTTGG - Intergenic
917462712 1:175246226-175246248 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
917496175 1:175542084-175542106 CTTGGCATGCCACTGGGTTTGGG + Intronic
918141581 1:181724515-181724537 CTTGGTCAGTTCCTGGGCGTTGG - Exonic
918755709 1:188337766-188337788 CTTGGCCCGTTACTGGGTTTTGG - Intergenic
918774497 1:188610790-188610812 CTTTGCCTGTTACTGGGCTTTGG + Intergenic
918815083 1:189171271-189171293 CTTGGTCTGTTACTGGGCTTTGG + Intergenic
918918226 1:190671836-190671858 CTTGGCCTGTTAATGGGGTTTGG - Intergenic
918958249 1:191237992-191238014 CTTGGCCTGTTACTGGCCTTTGG + Intergenic
919124611 1:193379738-193379760 CTTAGCCTGTTACTGAACTTTGG - Intergenic
919241777 1:194924247-194924269 ATTGGCCTGTTAATGGGCATTGG + Intergenic
919962422 1:202485157-202485179 CTTTGGCTGTTCCTGGGGTTGGG + Intronic
920197436 1:204238409-204238431 GTTGGTCTGTTACTGGGCTTTGG + Intronic
920997446 1:211009049-211009071 CATGGCCTCTTGCTGGCCTTGGG - Intronic
922781046 1:228252538-228252560 CTTGGCCTGTTACTGAGCTTTGG - Intronic
922786830 1:228287056-228287078 CCTGGCCTGTGGCTGGGCTTTGG - Intronic
923253565 1:232199394-232199416 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
924840772 1:247707789-247707811 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
924847128 1:247785094-247785116 TTGGGCCTATTACTGGGCTTTGG - Intergenic
1063216655 10:3931547-3931569 CTTGGTCTGTTACCTGGTTTTGG - Intergenic
1064345643 10:14530666-14530688 CTTGGAATGTAACTGGGCTGGGG + Intronic
1064517638 10:16168213-16168235 CTTGCCACGTTACCGGGCTTTGG - Intergenic
1064545684 10:16448092-16448114 CTTGGCCAGTTACTGGGCTTTGG - Intronic
1065005330 10:21374207-21374229 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1066156045 10:32679195-32679217 ATTGGCCTTTTATTGGGCTTTGG - Intronic
1066160318 10:32721236-32721258 TTTGGCCTGTTATTGGACATTGG - Intronic
1066167023 10:32799187-32799209 CTTGGCCTGTTACTGGGCTTTGG - Intronic
1066169432 10:32826361-32826383 CTTGTCCTATTACTGGGCTTTGG + Intronic
1067125549 10:43512501-43512523 CTTGGCCTATTACTGGGCTCTGG - Intergenic
1067333141 10:45340260-45340282 CTTGGCCTGTTACTGAGCTTTGG + Intergenic
1067518970 10:46980528-46980550 TTTGGCCTGCTACTGGGCCTTGG + Intronic
1067522987 10:47022062-47022084 CTGGGCCAGTTTCTGGGCTCAGG - Intergenic
1067643276 10:48071306-48071328 TTTGGCCTGCTACTGGGCCTTGG - Intergenic
1067694141 10:48523456-48523478 CTAAGCGTGTTTCTGGGCTTTGG + Intronic
1067754346 10:48993676-48993698 CTTGGTTTGTTACTGAGCTTTGG - Intergenic
1068007669 10:51409527-51409549 CTTGGCCTGTCACTGGGCTTTGG - Intronic
1068447214 10:57138636-57138658 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1068786131 10:60976424-60976446 CTTGACCTGTGAGTGGGCATTGG - Intronic
1068837212 10:61568335-61568357 CTTGGCCTGTTACTGGGCTGTGG - Intergenic
1069192299 10:65506327-65506349 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1069790825 10:71019540-71019562 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1070041481 10:72784786-72784808 CTTTGCCTTTTCATGGGCTTGGG + Intronic
1070275634 10:75003536-75003558 CTTGGGCTTTTGCTGGGTTTTGG + Intronic
1071267080 10:83973959-83973981 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1071673923 10:87637386-87637408 TTTGGCCTGTTACTGGGCCTTGG - Intergenic
1071937692 10:90549319-90549341 CTTGGCCTGTTCCTGGGCTTTGG + Intergenic
1071942778 10:90607735-90607757 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1072360472 10:94654186-94654208 CTTGGACTGTTACTCGGCTTTGG + Intergenic
1072878690 10:99203178-99203200 GCTGGCCTGTTGCTGGGGTTGGG - Intronic
1073557353 10:104465943-104465965 CTTGGTCTGTTACTGGGCTTTGG + Intergenic
1073656677 10:105424441-105424463 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1073918472 10:108432272-108432294 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1073957678 10:108891610-108891632 CTTGGCCTGTTACTGGGCCTCGG - Intergenic
1073995869 10:109314674-109314696 CTTGGCTTATTACTGGGCTTTGG - Intergenic
1075249717 10:120855916-120855938 CTTGTCCTGTTCCTGAGCTTAGG + Intronic
1075606793 10:123817442-123817464 CTTGGCCTGTTACTGGGCTTTGG + Intronic
1076772625 10:132674796-132674818 CTTGGCCTGTTACTGGGCTTTGG - Intronic
1076927412 10:133499183-133499205 CTTAGCCTGTTACTGGGCTTTGG - Intergenic
1078310677 11:10237948-10237970 TTTGGGCTGTTTCTGGGTTTTGG + Intronic
1079961422 11:26928759-26928781 CTTCGCCTGTTATTTTGCTTGGG + Intergenic
1080076597 11:28157538-28157560 CTTGGCCTGTTACTGGGCATTGG + Intronic
1080827792 11:35862372-35862394 CTGGGCCTGGGCCTGGGCTTGGG - Intergenic
1080973624 11:37308276-37308298 CTTGGCATTTTTCTGGGCTCAGG + Intergenic
1080980299 11:37394997-37395019 CTTTGCCTGTTACTGCCTTTAGG + Intergenic
1081065457 11:38534859-38534881 CTTGGCTTGTTATTGGGCTTCGG - Intergenic
1081072780 11:38631138-38631160 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1081880731 11:46449114-46449136 CTTGCCTTGTTCCTGGTCTTAGG - Intronic
1082225502 11:49702312-49702334 CTTAAAGTGTTACTGGGCTTGGG - Intergenic
1082671703 11:56043059-56043081 CTTTGCCTGCTACTGGGCTTTGG + Intergenic
1083093147 11:60221144-60221166 CTTGCCCTGTTACTGGACTTTGG + Intronic
1084446582 11:69207067-69207089 CTTGGCCTGTTATGGGGTTCGGG + Intergenic
1085349046 11:75786573-75786595 CTGGGCCGGTTTCTGGGCTGTGG - Intronic
1085747574 11:79128257-79128279 CTTGGCCTGTTACTGGGCTTTGG + Intronic
1086623575 11:88917265-88917287 CTTAAAGTGTTACTGGGCTTGGG + Intronic
1086834119 11:91600410-91600432 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1087011443 11:93517778-93517800 CTTGGCTTGTCACTTGGCCTGGG - Intronic
1087374025 11:97320571-97320593 CTTGGCCTGTTGCTAGGCTTTGG + Intergenic
1087397992 11:97626883-97626905 GTTGGCTTGCTACTGGGCCTTGG + Intergenic
1088097208 11:106115175-106115197 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1088191657 11:107234473-107234495 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1088265420 11:107983628-107983650 TTTGGCCTGCTGCTGAGCTTTGG + Intergenic
1088449357 11:109965385-109965407 CTTGGCCTGTTACCAGGCTTTGG + Intergenic
1088593470 11:111422708-111422730 CTTGTCCTGTTTCTGGCCTCGGG - Intronic
1088836659 11:113583406-113583428 CTTGGCCTGTCACTGGGCTTTGG + Intergenic
1088938088 11:114425164-114425186 CTTACAGTGTTACTGGGCTTGGG - Intronic
1088990489 11:114949380-114949402 TTTGGCCATTTTCTGGGCTTTGG + Intergenic
1089526481 11:119100629-119100651 CTTGGCCTGCATCTGGACTTGGG - Exonic
1089903609 11:122013626-122013648 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1090209489 11:124908033-124908055 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1090221613 11:125031568-125031590 CTTAGCCTGTTACTGGACTTTGG - Intronic
1091051741 11:132378773-132378795 TTTGGCCTGTTACTGAGCTTTGG + Intergenic
1091323139 11:134665549-134665571 TGTGGCCTGTCTCTGGGCTTAGG - Intergenic
1091702329 12:2672151-2672173 TTTGGCTTGGTACTGGACTTGGG - Intronic
1091702336 12:2672213-2672235 TTTGGCTTGGTACTGGACTTGGG - Intronic
1091708531 12:2718637-2718659 CTTGGCCTGTAAATTGGCTTAGG - Intergenic
1092381563 12:8000956-8000978 CCTGGTCTGTTACTGAGCTTTGG + Intergenic
1093031867 12:14295932-14295954 GTTGGCCTGTTACTGGGCTTTGG - Intergenic
1093036340 12:14335701-14335723 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1093146757 12:15575626-15575648 CGTAGCCTGCTACTGGGTTTGGG + Intronic
1093544382 12:20329055-20329077 TCTGGCTTGCTACTGGGCTTGGG + Intergenic
1093645732 12:21583688-21583710 CTTGGCCTGTTACTGGGCTTTGG + Intronic
1093964542 12:25310974-25310996 CTTGGCCTGTTGCTGAGCTTTGG + Intergenic
1094102534 12:26779280-26779302 CTTGGTCTGGTACTGGGCTTTGG + Intronic
1095121503 12:38424826-38424848 CTTGGCCTGTGACAGGGCTTTGG - Intergenic
1095603857 12:44044352-44044374 CTTGGCCTGTTTCTGGGCTTTGG + Intronic
1095628070 12:44341620-44341642 CTTGGCCTGTGACTGTGTTTGGG + Intronic
1095844392 12:46729950-46729972 CTTGGCCTGTTAATGGGCTAAGG - Intergenic
1095856237 12:46863657-46863679 CTTGGCCTGTTACTGGGCTTAGG - Intergenic
1096259100 12:50080004-50080026 CTTGGCCAGGTACTTGGCTGAGG - Exonic
1096288715 12:50322978-50323000 CTTGGCCTGCTACTGGGCTTTGG + Intergenic
1096457463 12:51799419-51799441 CTTGGCCTGTTACTGGGCTTTGG - Intronic
1096535932 12:52274657-52274679 CTTGGGCTGAAGCTGGGCTTTGG + Exonic
1096578701 12:52570669-52570691 CTTGGTCTGGTACAGGGCCTCGG + Exonic
1096584898 12:52613688-52613710 CTTGGTCTGGTACAGGGCCTCGG + Exonic
1096587461 12:52632097-52632119 CTTGGTCTGGTACAGGGCCTCGG + Intergenic
1096595787 12:52694626-52694648 CTTGGTCTGGTACAGGGCTTCGG + Exonic
1096599220 12:52717667-52717689 CTTGGTCTGGTACAGGGCCTCGG + Intergenic
1097350933 12:58548332-58548354 CTTGGCCTGTTCCTGGTCAAGGG - Intronic
1097437835 12:59572236-59572258 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1097821338 12:64131846-64131868 CTTGGCCTGTTACTGGGCTTTGG - Intronic
1097843354 12:64342743-64342765 CTTGGCCTGTTACTGGGCTTTGG - Intronic
1097990929 12:65832955-65832977 CTTTGCCTGTCATTTGGCTTTGG + Intronic
1098673044 12:73254262-73254284 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1098716093 12:73829833-73829855 CTTGGCCCGTTACTGGGCTTTGG + Intergenic
1098731054 12:74037366-74037388 GTTGGCCTGTTACTGGGCTTTGG + Intergenic
1099183377 12:79492570-79492592 CTTGGCCTATTACCGAGCTTTGG - Intergenic
1099365927 12:81765402-81765424 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1099375650 12:81893975-81893997 CTTGGCCTGTTACTAGGCTTTGG + Intergenic
1099379379 12:81936522-81936544 CTTGGCCTGTTACTGGGTTTTGG - Intergenic
1099508564 12:83507205-83507227 CTTGGCCTGCTACTGGGCTTCGG + Intergenic
1099689783 12:85938055-85938077 CTTTGTCTGTTACTGGGCTTTGG + Intergenic
1099735785 12:86565057-86565079 CTTGGCCTGTTACTGCGCTTTGG + Intronic
1100083306 12:90878230-90878252 CTTTGCCTGTTACTGGGCTTTGG + Intergenic
1100231951 12:92617872-92617894 TTTGGCCTGTTATTAGGCCTCGG + Intergenic
1100241149 12:92711590-92711612 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1100751148 12:97699345-97699367 CTTAGCAGGATACTGGGCTTTGG + Intergenic
1101264134 12:103066140-103066162 CTTGGCCAATTACTGGGATTTGG + Intergenic
1101534665 12:105606086-105606108 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1101543074 12:105682654-105682676 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1101852845 12:108418030-108418052 CTGGGCTTGCTACTGGGCTCTGG - Intergenic
1102686987 12:114732517-114732539 ATTGGCCTGTTGCTGTGCTTTGG - Intergenic
1102846479 12:116190117-116190139 CTTGTCCTGTTCCTGATCTTAGG + Intronic
1103035613 12:117654081-117654103 CTTGGCCTGTTACTAAGCTTTGG + Intronic
1103396530 12:120611465-120611487 CTTGACCTGTTACTGGGCTGTGG + Intergenic
1103844195 12:123890090-123890112 ATTGGCCGGTTCCTGGGCTTAGG + Intronic
1104075132 12:125381996-125382018 CTTAGCCCATTTCTGGGCTTGGG + Intronic
1105740112 13:23315194-23315216 CTTGGCCTGTTACTGGGCTTTGG + Intronic
1106762092 13:32877332-32877354 CTTGGCATGCTACTGGGCCTTGG + Intergenic
1106905534 13:34405413-34405435 CCTGGTGTGTTACTGGGCTGTGG - Intergenic
1107517761 13:41148254-41148276 CTTTGCCTGTTACTGCCTTTAGG - Intergenic
1107657694 13:42608967-42608989 CTTGGACTGTTACTGTGCAGTGG - Intergenic
1107983573 13:45755954-45755976 CTTGGCCTATTACTGGGCTTTGG - Intergenic
1108302431 13:49091967-49091989 CTTGGCCCGTTACTGGGCTTTGG - Intronic
1108904279 13:55449989-55450011 CTTGGCCTGTTACTGAGCTTTGG + Intergenic
1108914299 13:55588853-55588875 CTTGGCATGTTACTAGGCTTTGG - Intergenic
1109280228 13:60347999-60348021 ATTGGCCTGTTCCTGAGGTTTGG - Intergenic
1109293227 13:60500136-60500158 CTTGGCCTGTTACTGGGTTTTGG + Intronic
1109519025 13:63484819-63484841 CTTGGCTTGTTACTGGGCTTTGG + Intergenic
1109583051 13:64366185-64366207 CTTGGCCTGTTACTGGGCTTCGG + Intergenic
1109951021 13:69502187-69502209 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1110834132 13:80064611-80064633 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1111317505 13:86581819-86581841 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1112231125 13:97590146-97590168 CTTGGTTTGTTACTGGTCTTTGG - Intergenic
1112437727 13:99403594-99403616 CTTTTCTTGTTACTGGGGTTAGG - Intergenic
1112572763 13:100608562-100608584 CTGGGCCTGTACCTGGGCCTGGG + Intronic
1113985413 13:114311164-114311186 CTAGCTCTGTTGCTGGGCTTTGG - Intergenic
1114205873 14:20570787-20570809 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1114758255 14:25283858-25283880 CTTCACCTGTTACTGGGCTTTGG - Intergenic
1114905374 14:27120404-27120426 ATTGGCCTGTTACTTGTCTTTGG - Intergenic
1115059719 14:29173912-29173934 CTTGGCTTGTAACTGGGCTTTGG + Intergenic
1115070787 14:29319642-29319664 CTTAGCCTGCTACTGGGCCTTGG + Intergenic
1115130696 14:30049278-30049300 CTTGGCCTGTCACTGGGCTTTGG + Intronic
1115143402 14:30199405-30199427 CTTGGCCTGCTACTGGGCTTTGG + Intergenic
1115981389 14:39055673-39055695 CTTTGCCTGTTACTGCCTTTGGG - Intronic
1116058911 14:39896956-39896978 CTTGGCCTGTTGCTGGGCTTTGG + Intergenic
1116068097 14:40009189-40009211 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1116158375 14:41236647-41236669 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1116531453 14:45978207-45978229 CTTGGACTGTTACTAGGCTTTGG - Intergenic
1117596272 14:57329865-57329887 TTTGGCCTGTTATTGAGCTTTGG - Intergenic
1117634136 14:57724391-57724413 GTTGGCCTGTTACTGGGTTTTGG + Intronic
1118122431 14:62860152-62860174 CTTAGCCTGTTACTGGGCTTTGG - Intronic
1118880771 14:69824000-69824022 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1119107561 14:71938821-71938843 CTTGGCCTATTACTGGGCTTTGG - Intronic
1119861050 14:77936344-77936366 CTGGGCCTTCTACTTGGCTTGGG + Intergenic
1119991203 14:79199696-79199718 GTTGGCCTGGTACTGGATTTTGG + Intronic
1120082022 14:80227512-80227534 CTTTGCCTGTTCCTGGGCCTTGG - Intronic
1120231421 14:81845233-81845255 GTTGGCCTGTTACTGGACTGTGG - Intergenic
1120555989 14:85930420-85930442 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1120784809 14:88523524-88523546 CTTGTCTTGTTACTGATCTTAGG - Intronic
1122214621 14:100194647-100194669 CTTGGCCTGATGCTGGAGTTGGG - Intergenic
1122306995 14:100772734-100772756 CTTGGGCGGTTACAGGGCGTGGG - Intergenic
1124697675 15:31879276-31879298 CTTGCCTTGTTTCTGGCCTTAGG + Intergenic
1125679119 15:41519963-41519985 CTTGCTCTGTCACTGGGCTGGGG + Intronic
1126283613 15:46986295-46986317 CTTGGCCTGTTATTGGGCTCTGG + Intergenic
1126444017 15:48721645-48721667 CTGAGCCTGGCACTGGGCTTTGG + Intronic
1126584292 15:50267473-50267495 ATTGGCCTGTTACTGACCATGGG + Intergenic
1127356919 15:58209207-58209229 CTTGGCCTGTTATTGGGCTTTGG + Intronic
1127513216 15:59664723-59664745 CTTGACCTGTAACTTGGCTGTGG + Intronic
1128536132 15:68491979-68492001 CTGTGCCTGTCACTGGGCTTGGG - Intergenic
1129108828 15:73325726-73325748 GATGTCCTGTCACTGGGCTTTGG - Intronic
1129492182 15:75938064-75938086 TTTGGCCTGCTTTTGGGCTTAGG - Exonic
1130447138 15:84013836-84013858 CTTAGCATTTTGCTGGGCTTTGG - Intronic
1131724013 15:95202813-95202835 CTTGGCCTGTTACCGGGCTTTGG + Intergenic
1132489554 16:218837-218859 CTTGGCCTCTCACTGGTATTGGG - Intronic
1132803412 16:1764996-1765018 CTTGGCCTGTTTCAGGGCACGGG - Exonic
1132984104 16:2754900-2754922 TTGGGTCTGCTACTGGGCTTGGG + Intronic
1134325407 16:13203057-13203079 CTTTGACTGTTACTGAGATTGGG + Intronic
1135735752 16:24930876-24930898 CTGGGCCGGTTCCTTGGCTTTGG + Exonic
1136250943 16:29004609-29004631 CTTGGCCTGTTAAAGAGCTCTGG + Intergenic
1136997974 16:35203712-35203734 CATGGCCTGTTCTTGGTCTTTGG - Intergenic
1137121214 16:36719033-36719055 CTTGGCCTCTTAGAGGCCTTCGG + Intergenic
1137652808 16:50134930-50134952 CTTGGCCTGCTCCTGAGCCTTGG - Intergenic
1138868387 16:60850800-60850822 CTTTTCCTGTTATTGGGCTTTGG + Intergenic
1141559540 16:84858020-84858042 CTTGGCCTGTTACTGGGCTTTGG - Intronic
1144067429 17:11637209-11637231 CTTGGCATGGTACTGCCCTTTGG - Intronic
1144269871 17:13605406-13605428 CTTCTCATGTTACTGGGCATCGG - Intergenic
1144625516 17:16842510-16842532 AATGGCATGTTTCTGGGCTTTGG - Intergenic
1144880912 17:18430211-18430233 AATGGCATGTTTCTGGGCTTTGG + Intergenic
1145151320 17:20514176-20514198 AATGGCATGTTTCTGGGCTTTGG - Intergenic
1146237986 17:31185966-31185988 CTTGACCTGTTACTGGGCTTTGG + Intronic
1146836358 17:36114018-36114040 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1146850936 17:36221058-36221080 CTTAGCCTGTTACTGGGCTTTGG + Intronic
1147579673 17:41621205-41621227 AATGGCATGTTTCTGGGCTTTGG - Intronic
1151037809 17:70821580-70821602 CTTGGCCCATTATTTGGCTTTGG - Intergenic
1151548436 17:74807429-74807451 CTGGGCCTGTGGCGGGGCTTTGG + Intronic
1153089712 18:1330176-1330198 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1154129532 18:11724810-11724832 CTTGGCCTGCTCCTGGGCCTTGG - Intronic
1154252669 18:12757261-12757283 CTTGGCCTGTTACTAGGCTTTGG - Intergenic
1154506175 18:15042904-15042926 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1154993394 18:21617123-21617145 CTTTGCCTGTTACACGTCTTTGG + Intronic
1155940710 18:31799612-31799634 CTTGGTCTGTTACTGGGCTTTGG + Intergenic
1156303863 18:35858708-35858730 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1156582553 18:38394478-38394500 CTTAGCCTATTACTGGGCTTTGG + Intergenic
1156606374 18:38671779-38671801 CTTGGCCTGTGATTGGGCTTTGG + Intergenic
1156990300 18:43400761-43400783 CTTGGGCTATTACTGGGCGTTGG - Intergenic
1157341205 18:46780041-46780063 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1157870929 18:51229567-51229589 CTTGGTCTGCTACTGGGCCTTGG - Intergenic
1157998503 18:52588110-52588132 CTTGGCCTGTTACTGGACTTTGG - Intronic
1158748654 18:60231772-60231794 CTTGGCATGTCACTGGGAGTGGG - Intergenic
1159105279 18:63997188-63997210 ATTGTCCTGTTATTGGGCCTAGG + Intronic
1159125671 18:64221234-64221256 CTTGCCTTGTTACTGATCTTAGG + Intergenic
1159248875 18:65847742-65847764 TCTGGCCAGTTACTGGGGTTTGG - Intronic
1159287791 18:66375496-66375518 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1159559102 18:69975337-69975359 CTTGGCTTGTTACTGGGCTTTGG - Intergenic
1160066199 18:75576377-75576399 CTTGGCTTGGTCCTGGGCCTTGG + Intergenic
1160092466 18:75840029-75840051 CTTGGCCTGTTACTGGGCTCTGG + Intergenic
1160532183 18:79571978-79572000 CTCGGGCTTTTCCTGGGCTTGGG - Intergenic
1160713964 19:566768-566790 CTTTGCCTGTTGCTGGCTTTGGG + Intergenic
1160841300 19:1148035-1148057 CTTGGCCAGCTCCTGCGCTTGGG + Intronic
1160940015 19:1615814-1615836 CTAGGCCTGTTGCAGGGCTAGGG - Exonic
1161801022 19:6416813-6416835 CTTGGCCTCTTCCTCGGCCTCGG + Exonic
1162240512 19:9349421-9349443 CTTGTCTTGTTTCTGGTCTTGGG + Intronic
1162452737 19:10764592-10764614 CTTGGCCTTGAACTGGCCTTTGG + Intronic
1164097083 19:22021329-22021351 CTTGGCCTATTACTGGGCTTTGG - Intergenic
1164117255 19:22234560-22234582 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1164681769 19:30139072-30139094 ATTTGCCTGCTTCTGGGCTTGGG + Intergenic
1166905016 19:46101973-46101995 CTATGCCTGTTACTGCCCTTGGG - Intergenic
1167175483 19:47861143-47861165 CTGGGCCTGGGACTGGGCCTGGG - Intergenic
925279955 2:2676882-2676904 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
925460729 2:4060460-4060482 CTTTGTCTATTACTGGGCTTTGG + Intergenic
926810393 2:16750662-16750684 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
926825565 2:16902216-16902238 CTTGGCTTGTTACTGAGCTTTGG - Intergenic
926826765 2:16913682-16913704 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
927008720 2:18879738-18879760 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
927660434 2:24988683-24988705 CTTGGCCTGTTACTGGTCTTTGG + Intergenic
929269823 2:39960767-39960789 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
929432312 2:41897620-41897642 CTTGGCCAGTTACCTTGCTTTGG - Intergenic
930418607 2:51121009-51121031 TTTGGCCTGTTACTGGGCCTTGG + Intergenic
930536608 2:52652248-52652270 CTTGGCCTGTTACTAAGCTTTGG - Intergenic
932870703 2:75395067-75395089 CCTGGCCTGTTACTGGGCTTTGG - Intergenic
932980860 2:76664254-76664276 CTTGGCCAGTTCCGGGGATTGGG - Intergenic
935183938 2:100714915-100714937 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
935425107 2:102911311-102911333 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
935694679 2:105761026-105761048 CCTGGTCTGTGACTGGGCTCAGG + Intronic
935944627 2:108274349-108274371 CTTGGCCTGCTACTGGGCCTAGG - Intergenic
936084989 2:109461291-109461313 CTTGGTCTGCCACTGGGCCTTGG - Intronic
936230108 2:110693012-110693034 GTTGGCCTGTCACTAGGCTGCGG + Intergenic
936641228 2:114314706-114314728 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
937582062 2:123499151-123499173 CTTGGCCCATTACTAGGCTTTGG - Intergenic
937785203 2:125887712-125887734 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
937800328 2:126074744-126074766 CTTGGCTTGTTAGTAAGCTTTGG + Intergenic
937852567 2:126648722-126648744 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
938419309 2:131131428-131131450 CTCGTCCTGTTTCTGGCCTTAGG + Intronic
939069065 2:137517872-137517894 CTTGGCCTGTTACTGGGCTTTGG + Intronic
939213875 2:139212256-139212278 CTTGGCCTGTTATTGGGCTTTGG + Intergenic
939788682 2:146546097-146546119 CTTGGCCTGTTACTGGGGTTTGG - Intergenic
939806243 2:146778490-146778512 CTCGGCCTATTACTGGGCTTTGG + Intergenic
940171311 2:150832696-150832718 CTTGGCCTGTTACTAGGCTTTGG - Intergenic
940472087 2:154113111-154113133 CTAGACCTGTTACTGGGCTTTGG - Intronic
940605913 2:155924272-155924294 CATGGCCTGTTACTGGGCTTTGG - Intergenic
941330665 2:164174549-164174571 CTTTGCCTGTTACTGGGCTTTGG - Intergenic
941668019 2:168261144-168261166 CTCTGCCTGTTACTGGGCTTTGG + Intergenic
941868749 2:170361684-170361706 CTTGACCTGCTACTTGGCTCTGG + Intronic
943006899 2:182395857-182395879 CTTGGCCTGTTATTAGGCTTTGG + Intronic
943239216 2:185362556-185362578 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
943317926 2:186412303-186412325 CTTGGTCTGTTACTGGGCTTTGG - Intergenic
943384061 2:187181074-187181096 CTTTACCTGTTACTGGGCTTTGG - Intergenic
943385881 2:187203234-187203256 CTTGGCCTGCTACTGGGCTTTGG - Intergenic
943517595 2:188907226-188907248 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
943895332 2:193350488-193350510 CTGGGCCTATCACTGAGCTTGGG + Intergenic
945544871 2:211138173-211138195 CTTGGCCTGTTACTGAGCTTTGG + Intergenic
945642181 2:212443853-212443875 CTTGGACTATTACTGGGCTTTGG + Intronic
945725842 2:213471479-213471501 GTTGGTCTGTTACTGGGCTTTGG - Intronic
946254328 2:218432024-218432046 CCTGGCCTGATACTGGCCCTAGG + Exonic
946527865 2:220539951-220539973 CTTGGCCCGTTACTGGGCTTTGG - Intergenic
946562008 2:220924562-220924584 CTTGGCATGTTCCTGGCCCTTGG + Intergenic
946703772 2:222437776-222437798 CTTGGCCTGTTACTAGGCTTTGG - Intronic
946790924 2:223299776-223299798 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
947440711 2:230118650-230118672 CCAGGCCTATTACTGGGCTTTGG - Intergenic
947440849 2:230120273-230120295 CTGGGCCTATTACTGGTCTTTGG + Intergenic
948723194 2:239916494-239916516 CTTGGCCTGTGACGGGCATTTGG - Intronic
1168750346 20:277474-277496 CTTGGCCAGTAACTGGGGTCTGG + Intronic
1168801691 20:647473-647495 CTTGGCCTGGAACTGGGACTAGG - Exonic
1169118998 20:3084268-3084290 CTTCCCCGGTGACTGGGCTTGGG - Intronic
1170021473 20:11841080-11841102 CTTGGCTTGATACTCTGCTTGGG + Intergenic
1172130834 20:32653636-32653658 CTTGTCTTGTTCCTGGTCTTGGG - Intergenic
1175067310 20:56300337-56300359 TTTGGCCTGTTCCTGATCTTTGG - Intergenic
1176687621 21:9865191-9865213 CTTTGCCTGTTACTGCCTTTGGG - Intergenic
1176791678 21:13326120-13326142 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1176998163 21:15580200-15580222 CTTGGCCTGTTACTGGGCTTCGG + Intergenic
1177139413 21:17342253-17342275 CTTGGCCTGTTACTGGGTTTTGG - Intergenic
1177505558 21:22014166-22014188 TTTGGCCTGCTACTGGGCTTTGG - Intergenic
1177913178 21:27056226-27056248 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1177933695 21:27316916-27316938 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1177991069 21:28037122-28037144 TGTGGCCTGTTACTGGGCTTTGG - Intergenic
1178012662 21:28305191-28305213 CTTGGCCTGCTACTGGACTTTGG + Intergenic
1178060752 21:28851122-28851144 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1178350894 21:31872817-31872839 CTTGCCCGGATTCTGGGCTTGGG - Intergenic
1179415147 21:41192505-41192527 CTTGGCCTGTTACTGGGCTTTGG - Intronic
1180058932 21:45374897-45374919 CTTGGCCTGAAAATGGGCATTGG + Intergenic
1180894150 22:19316113-19316135 CTTTGCCTGTTACTGACTTTGGG - Intergenic
1181367434 22:22388928-22388950 CTTGGCCTATTACTGGGCTTTGG - Intergenic
1181420656 22:22795847-22795869 GTTGGCCTGTTACTGGGCTTTGG + Intronic
1181442709 22:22944937-22944959 CGTGGCCGGCTTCTGGGCTTGGG + Intergenic
1181599961 22:23944910-23944932 CTTGTCCTGTTCCTGATCTTAGG - Intergenic
1181608542 22:23996408-23996430 CTTGTCCTGTTCCTGATCTTAGG + Intergenic
1183284121 22:36952013-36952035 CTGGGCCTGGTTCTGGGCTGGGG - Intergenic
1184091022 22:42293081-42293103 CTTGGCCTCCTCCTGGGCTTGGG - Intronic
1184603558 22:45558359-45558381 CTTGGCCTGTTACTGGGCTTTGG - Intronic
949125662 3:443130-443152 CTTTGCCTGTTACTGGGCTTTGG - Intergenic
949170037 3:986588-986610 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
949245871 3:1924938-1924960 CTTGGTCTGTTACTGGGCTTTGG + Intergenic
949417590 3:3830867-3830889 CTTGGCCTGTTACTAGGCTTTGG - Intronic
949638782 3:6012532-6012554 CTCAGCCTGTTACTGGGCTTTGG + Intergenic
949700685 3:6753726-6753748 CTTGGCATGCTCCTGAGCTTTGG - Intergenic
951058941 3:18181722-18181744 CTCAGCCTGTGACTGGGGTTGGG + Intronic
951122574 3:18945582-18945604 CTAGGCCTGTTACTGGGCTTTGG + Intergenic
951249118 3:20373530-20373552 CTTGGCCTTTTACTAGGCCATGG + Intergenic
951291516 3:20876730-20876752 CTTGGCCTATTATTGGGCTTTGG - Intergenic
951384528 3:22027550-22027572 CTTGGCCTGTTACTGGGCTTTGG + Intronic
951951847 3:28207542-28207564 CTCAGCCTGGAACTGGGCTTGGG - Intergenic
951970760 3:28441850-28441872 CTTGGTCTGTTACTGGGCTTTGG - Intronic
952605440 3:35142000-35142022 CTTGGCTTGTTACTGGGTTTTGG - Intergenic
953286444 3:41614919-41614941 CTTGTGCTGTTACTGAGCTAGGG + Intronic
954152403 3:48664002-48664024 CCTGACCTCTTCCTGGGCTTCGG - Intergenic
954511488 3:51129646-51129668 CTTGGCCTGTTACTGGGCTTTGG - Intronic
956360455 3:68441453-68441475 CTTGGCCTGTTACTGGGCTTTGG + Intronic
956703892 3:71982872-71982894 CTTGGCCTATTACTGGGCTTTGG - Intergenic
957247581 3:77733882-77733904 TTTGGCCTGTTACAGAGCTTTGG - Intergenic
957754600 3:84469441-84469463 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
958477413 3:94602465-94602487 GTTGGCATGTTACTAGGCTTTGG - Intergenic
958487675 3:94732459-94732481 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
958934305 3:100240643-100240665 CTGGACCTGTTACTGGGCTTTGG + Intergenic
958951084 3:100416886-100416908 CTGGGCCTGTTGCTGGGTTAGGG - Intronic
959100163 3:102001086-102001108 CCTAGCCTGCTACTGGGCCTTGG - Intergenic
959203648 3:103279230-103279252 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
959226776 3:103597261-103597283 TTTGGCCTGTTACTGGGCTTTGG - Intergenic
959439511 3:106359197-106359219 CTTGGCCTTTTACTGGCCTTTGG + Intergenic
959746010 3:109777258-109777280 TTTGGACTGTTACTGGGGTTTGG - Intergenic
959997862 3:112698335-112698357 CTTGGCCTGCTACTGGGCTTTGG + Intergenic
960349532 3:116575716-116575738 CTTGGTCTGTTACTGGGCTTTGG + Intronic
960421698 3:117454355-117454377 ATAGGCCTGTAACTGGGATTTGG - Intergenic
960494745 3:118360765-118360787 CTTGGCCTGTTACTTGACTTTGG - Intergenic
960982870 3:123248135-123248157 CTTGCCCTGTTCCTGGTCTTAGG - Intronic
961262848 3:125616438-125616460 CTTGGCCTGTTACTGTGCCTTGG + Intergenic
961438668 3:126937492-126937514 CTTGGCCTGTCCATGGGCTTTGG + Intronic
961749489 3:129087027-129087049 CAGGGCCTGTGCCTGGGCTTTGG - Intergenic
962985326 3:140531066-140531088 CTAGGCCTGTTATTGGGGTGGGG - Intronic
963331814 3:143923358-143923380 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
963355660 3:144206845-144206867 CTTGGCCCATTTCTGGGCTTTGG - Intergenic
963453673 3:145516682-145516704 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
963630312 3:147723235-147723257 TCTGGTCTGTTACTGGGCTTTGG + Intergenic
963661396 3:148132160-148132182 CTTGACCTGTTACTGGGCTTTGG + Intergenic
964505863 3:157398308-157398330 TTTGGCCTGCTACTGGGCCTTGG - Intronic
964679242 3:159318899-159318921 CATGGCCTGTTACTGGGCTTTGG - Intronic
965226764 3:166000749-166000771 CTTGGCCTGTTAGTGGGCTTTGG - Intergenic
966044327 3:175530906-175530928 CTTGGCCTGTTACTGGGCTTTGG - Intronic
966445696 3:179998574-179998596 CTTGGTCTGTTACTGGGCTTTGG + Intronic
967831779 3:193926005-193926027 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
968499147 4:938115-938137 CTTGGCTTGTTCCTGGTCTTAGG - Intronic
968727553 4:2255400-2255422 GTGGACCTGTTACTGGGTTTTGG - Intronic
968800186 4:2738136-2738158 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
968906949 4:3457982-3458004 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
969362227 4:6672238-6672260 CTCGCCCTGTCACTGGGCTGGGG + Intergenic
971101011 4:23466407-23466429 CTTGACCTGTTACTGCGCTTTGG - Intergenic
971278866 4:25224504-25224526 CTTTGCCTGTTACTGCCTTTGGG + Intronic
971857651 4:32062818-32062840 CTTGACCTGTTACTGGGCCTTGG - Intergenic
971979292 4:33732858-33732880 CTTGGCCTGCTATTGGGCTTTGG - Intergenic
972095496 4:35342704-35342726 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
972805919 4:42529342-42529364 CTTGGCTTGTTACTGGGCTTTGG + Intronic
972882958 4:43448139-43448161 GTTTGCCTGTGACTGGGCTTTGG - Intergenic
973102927 4:46294767-46294789 CTTGGCCCATTACTGGGCTTTGG + Intronic
973118445 4:46489058-46489080 CTTGGCCTGTTACTGGGCTCTGG + Intergenic
973120978 4:46520883-46520905 CTTGGCCTGTTACTGGGCTGTGG - Intergenic
973286089 4:48418225-48418247 CTTGTCTTGTTCCTGGTCTTAGG + Intronic
974262368 4:59542254-59542276 CTTGGCCTGTTACTGGGTTTTGG - Intergenic
974289572 4:59912757-59912779 CTTGGCTTGTCACTGGGCTTTGG + Intergenic
974644613 4:64674749-64674771 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
974727215 4:65812538-65812560 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
974746912 4:66088890-66088912 CTTGGTCTGTTACTGGGCTTTGG - Intergenic
975110475 4:70617845-70617867 GTTTCCCTGTTTCTGGGCTTGGG - Intergenic
975386714 4:73767494-73767516 TTTGGCCTGTTACTGGGCTTTGG - Intergenic
975656063 4:76642313-76642335 CTTACCCTGTTACATGGCTTTGG - Intronic
975671104 4:76781464-76781486 CATTGCCTGTTACTGTGCTGTGG - Exonic
975776634 4:77794696-77794718 CTTGCCCTGTTTCTGATCTTAGG - Intronic
976034203 4:80795807-80795829 CTTGGTCTGTTAGTGGGCTTTGG - Intronic
976573859 4:86645306-86645328 CTTGACCTGTTCCTGATCTTAGG - Intronic
977031625 4:91891422-91891444 CTTTTTCTGTTACTGGGCTTTGG + Intergenic
977430769 4:96928227-96928249 TTTGGCCTCTTACTGGGCTTTGG + Intergenic
977466004 4:97383389-97383411 CTTGGTCTGTTACTGGGCTTTGG + Intronic
977490068 4:97700056-97700078 CTTGGCCTGTTACTGGGCTTTGG - Intronic
977626273 4:99192639-99192661 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
977701728 4:100029872-100029894 CTTGGCCTGTTACTGGGTTTTGG - Intergenic
977833272 4:101618153-101618175 CTTGGCCTGTTACTGGGCTTTGG - Intronic
977930409 4:102743804-102743826 CTTGGCCTGTTACTGGGCTTTGG - Intronic
978341587 4:107725534-107725556 TGTGGCCTGTTACTGGGCTTTGG - Intergenic
978772149 4:112467765-112467787 TTTGGCCTGTTACTGGGCTTTGG - Intergenic
978899072 4:113926803-113926825 CTTGGCCTGTTACTGGGCTTTGG - Intronic
978966855 4:114750957-114750979 CTTGGGCTTTTACTGGGCTTTGG + Intergenic
979767023 4:124474610-124474632 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
979888565 4:126062158-126062180 CTTGGCCTGCTATTGGGCCTTGG - Intergenic
979898399 4:126189042-126189064 CTTGGCCTTTTACTGGGCTTTGG - Intergenic
980350970 4:131683007-131683029 CTTTGCCTGTTACTGCCTTTGGG - Intergenic
980387945 4:132111166-132111188 CTTGGCCTGTTACTGGACTTTGG - Intergenic
980405888 4:132353776-132353798 TTTGGCCTGTTACTGGGCTTTGG - Intergenic
980497524 4:133605347-133605369 CTTGGCCTGTTATTGGGCTTTGG - Intergenic
980957734 4:139445932-139445954 TTTGGCCTGTTACTGGGCTTTGG + Intergenic
981835006 4:149043960-149043982 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
981873540 4:149515211-149515233 CTTGGCCTGTTACTAGGCTTTGG + Intergenic
982597774 4:157407011-157407033 CTTGGCCTATTTCTAAGCTTTGG - Intergenic
982623338 4:157732886-157732908 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
982819294 4:159926543-159926565 CTTTGCCTGTTACTGCCTTTGGG + Intergenic
982835542 4:160116656-160116678 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
982851046 4:160316641-160316663 TTTGGCCTGCTACAGGGCCTTGG - Intergenic
983027393 4:162755310-162755332 CTTGGCCTGTTACTGGGATTTGG + Intergenic
983185066 4:164691590-164691612 CTTGGCCTCGTACTAGGCTTTGG + Intergenic
983582678 4:169324827-169324849 CTTGGCTTGTTACTGGGTTTTGG + Intergenic
984004511 4:174293135-174293157 GTGGGCCTGTTACTGGGGCTTGG + Intronic
984060281 4:174982009-174982031 CTTGGCCTGCTACTGGGCTTTGG - Intergenic
986025576 5:3847429-3847451 CTTGGCCTGTTGCTGGATTTTGG + Intergenic
986037030 5:3950422-3950444 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
986742922 5:10719521-10719543 CTTGGCCTGTTACTGGGCTTTGG + Intronic
986938329 5:12918735-12918757 CTTGGCCTATTACTGGGCTTTGG - Intergenic
987153179 5:15061681-15061703 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
987468186 5:18296969-18296991 CTTGGCCTATTACTGGGCCTTGG - Intergenic
987578339 5:19758296-19758318 CTTGGCCTGTTACTGGACTTTGG - Intronic
987657135 5:20821636-20821658 CTTGGCCTATTACTGGGCTTTGG - Intergenic
987885447 5:23806515-23806537 GTTGGCCTATTACTGGGCTTCGG + Intergenic
988056566 5:26105252-26105274 CTTGGCCTGTTACTCGGCTTTGG - Intergenic
988079828 5:26401404-26401426 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
988107761 5:26772562-26772584 CTTGGCTTTTTGCTGGGCTTTGG + Intergenic
988160822 5:27516855-27516877 CTAGGCCTGTTACTGGGCTTTGG - Intergenic
988169199 5:27632822-27632844 TTTGGCCAGTTACTGGGCTTTGG - Intergenic
988228771 5:28448142-28448164 CATGGCCTGTTACTGGGCTTTGG + Intergenic
988233285 5:28507074-28507096 CATGACTTGTTACTGGGCTTTGG - Intergenic
988562133 5:32290863-32290885 CTTGGCCCGTTACTGGGCTTTGG + Intronic
988766416 5:34382312-34382334 CTTGGCCTATTACTGGGCTTTGG + Intergenic
989045203 5:37267575-37267597 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
989307500 5:39974607-39974629 CTTGGCCTATAACTGGGCTTTGG - Intergenic
989457640 5:41661752-41661774 CTTGGCCTGTTACTAGGCTTTGG - Intergenic
989486381 5:41996343-41996365 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
991033547 5:62105938-62105960 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
991330734 5:65489668-65489690 CTTGGCTGGTTACTGGGCTTTGG - Intergenic
991946149 5:71900157-71900179 GTTGGCCTGTTACTGGGCTTGGG + Intergenic
991955180 5:71987270-71987292 CTTGGCATGATACTGGGCCCTGG + Intergenic
992242958 5:74789883-74789905 CTTGGCCTGTTACTGGGCTTTGG + Intronic
993203394 5:84847556-84847578 CTTGACCTGTTACTAAGCTTTGG + Intergenic
993231898 5:85247517-85247539 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
993319829 5:86458594-86458616 CTTGGCTTGTTACCGGGCTTTGG + Intergenic
993367465 5:87050940-87050962 ATTGGTCTGTTACTGGGCTTTGG - Intergenic
993412579 5:87591796-87591818 CTTGGCCTGTTACTGGGTTTTGG - Intergenic
993780696 5:92062410-92062432 CTTGACTTGTTACTGGGCTTTGG + Intergenic
994291369 5:98031955-98031977 CTTGGCCTGTTACTGGGGTTTGG - Intergenic
994984417 5:106915713-106915735 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
995189507 5:109305710-109305732 CGTGGGCTGGTACTAGGCTTTGG - Intergenic
995269554 5:110205450-110205472 CTTGGCCCAATACTGGGCTTTGG - Intergenic
995509550 5:112894364-112894386 CTTGGCCTCCTAATGTGCTTAGG + Intronic
995776284 5:115727663-115727685 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
996018563 5:118567872-118567894 CTTGGTCTGTTACTGGGCTTTGG + Intergenic
996164953 5:120212492-120212514 TTTGGCCTGTTACTGGGCTTTGG - Intergenic
996622237 5:125520959-125520981 CTTGTCTTGTTTCTGGTCTTAGG + Intergenic
996825565 5:127677851-127677873 CTTGGCCTGTTATTGGACTTCGG + Intergenic
998290333 5:140908535-140908557 CTTGGCCTATTACTGGGCTTTGG - Intronic
998410502 5:141907009-141907031 CTGGGCTTGTTCCTGGGCTCTGG - Intergenic
998421288 5:141989307-141989329 CTGGGCTTGTGACTGAGCTTAGG + Exonic
999351388 5:150874861-150874883 CTTGGCCTGTCACTGGGTTTTGG + Intronic
1000193189 5:158933020-158933042 CTTTTCCTTTCACTGGGCTTAGG + Intronic
1000223242 5:159234232-159234254 CTTGGCTTGTTACTGGGCTTTGG - Intergenic
1000325536 5:160169320-160169342 CTTGGCCTCTTCCTGGGCACAGG + Intergenic
1000416975 5:160993918-160993940 CTTGGCCTGTTATTGGGCTTTGG + Intergenic
1000936753 5:167311081-167311103 CTTGGCTTGGTCCAGGGCTTAGG + Intronic
1001173598 5:169444659-169444681 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1001955233 5:175844172-175844194 CTTGGCCTCTGGCTGGGCATTGG - Intronic
1002555388 5:180033970-180033992 CTTGGCTTGTTCCTGATCTTAGG + Intronic
1002774405 6:316402-316424 CTTCGCCTGTTTCTGTGCTCAGG + Intronic
1002900930 6:1409105-1409127 CTTGGCCCTTTTGTGGGCTTGGG - Intergenic
1002997968 6:2304762-2304784 TCTTGCCTGTCACTGGGCTTTGG + Intergenic
1003023142 6:2529503-2529525 CTTGGCATGTTACCAGGCTCTGG + Intergenic
1003394842 6:5744181-5744203 CTGGGCCTGTTACAGGCCTAGGG + Intronic
1003695895 6:8406123-8406145 CTTGGCCTGTTACAGGGCTTTGG - Intergenic
1003791223 6:9550008-9550030 CTTGGCCTATTACTGGGATTTGG + Intergenic
1004824286 6:19403219-19403241 CTTGGACTGTTACTGGGCTTTGG - Intergenic
1005185172 6:23157089-23157111 GTTGGGCTGTTATTGGGCTTTGG + Intergenic
1005976212 6:30801808-30801830 CTTGACCTGTTAGTTGGCTAGGG + Intergenic
1006001559 6:30969092-30969114 CTTGGCCTATTACTGGGCTTTGG + Intergenic
1006062354 6:31433239-31433261 CTTAGCCTGTTACTGGGCTTTGG + Intergenic
1007100736 6:39244658-39244680 TTTGGTCTGATACAGGGCTTGGG + Intergenic
1007191397 6:40022100-40022122 CTTGGCCTGTTAGGGGTGTTAGG + Intergenic
1007961964 6:45968100-45968122 CTTTGCCTGTGACTAGGCTGGGG - Intronic
1008266920 6:49439272-49439294 CTTGGCCTGTTACTGGACTTTGG - Intronic
1008400293 6:51055488-51055510 CTTGGCCTTTTACTGAGTTTTGG + Intergenic
1008691243 6:53981621-53981643 CTTGGACTGGTACTGGTCTGTGG + Intronic
1009390109 6:63135061-63135083 TTTGGCCTGTTACTGGGCTTTGG - Intergenic
1009660692 6:66606905-66606927 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1009770331 6:68136835-68136857 CTTGGCCTGCTACTGGGCCTTGG - Intergenic
1009851924 6:69208941-69208963 CTTGGCCTGTTACTGCGCTTTGG - Intronic
1010325327 6:74556582-74556604 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1010580751 6:77593888-77593910 CTTGGCCTGTTACTGGACTTTGG - Intergenic
1010818634 6:80388417-80388439 CCTGGCCTGTTACTGAGCTTTGG + Intergenic
1010938243 6:81886400-81886422 CTTGGCCTGTTACTGGGTTTTGG - Intergenic
1011039341 6:83013257-83013279 CTTAGCCTGTTACTGGGCTTTGG - Intronic
1011069105 6:83361682-83361704 CCTGGCCTGTTACTGGGCTTTGG + Intronic
1011504947 6:88031185-88031207 CTTTGCCTGTTACTGCCTTTGGG - Intergenic
1012001908 6:93664463-93664485 TTTAACCTGTTACTGGGCCTTGG + Intergenic
1012108566 6:95197720-95197742 CCTGTCATGTTACTGGGCTTTGG - Intergenic
1012344591 6:98170336-98170358 GTTGGCCTATTACTGGGCTTTGG + Intergenic
1012730464 6:102874336-102874358 CTTGGCCTGTTACTGGGTTTTGG + Intergenic
1012820807 6:104082935-104082957 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1012873276 6:104696468-104696490 CTTGGGCTGAGCCTGGGCTTTGG - Intergenic
1012920792 6:105219528-105219550 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1013406674 6:109849819-109849841 CTTGGCCAGTTACTGGGCTTTGG + Intergenic
1014363394 6:120508337-120508359 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1014416989 6:121195406-121195428 CTTGGCATGTTACTGGGCTTTGG + Intronic
1014534194 6:122596605-122596627 CTTGGCCTATTACTGGGCTTTGG - Intronic
1014631643 6:123796818-123796840 CTTGACCTGTTACTGGGCTTTGG + Intergenic
1014833676 6:126132434-126132456 CTTTGCCTGTTACTTGACTTTGG + Intergenic
1014895656 6:126896591-126896613 CTTGGCCTGATAATGGACCTTGG + Intergenic
1015095447 6:129409584-129409606 CTTGGCCTGTTACTGGGCTTTGG - Intronic
1015370973 6:132452312-132452334 CTTGGCTTGTTTCTGGTCTTAGG - Exonic
1015443282 6:133272548-133272570 CTTGGCCCATTACTGGGCTTTGG - Intronic
1015475752 6:133657508-133657530 CTTGGCTTGTTACTGGGCTTTGG + Intergenic
1016144292 6:140649419-140649441 CTTGGCCTGTTACTGGACTTTGG + Intergenic
1016174912 6:141069078-141069100 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1016419612 6:143870665-143870687 CTTGGCCTGTTACTGGGCTTTGG - Intronic
1016576255 6:145572570-145572592 CTTGGTCTGTTACTGGGCTTTGG - Intronic
1016620813 6:146107483-146107505 CTTTGCCTATTACTGGCCTGAGG + Intronic
1017227804 6:152041075-152041097 CTTGGCCTGTTACTGTGCTTTGG - Intronic
1017388454 6:153912190-153912212 CTTGGCCTGTTACCAGGCTTTGG - Intergenic
1017977113 6:159368040-159368062 CTTGGTTTGTTACTGGGCTTTGG - Intergenic
1018122925 6:160655206-160655228 ATTGGTCTGTTATTGGGCTTTGG - Intronic
1018535027 6:164810477-164810499 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1018599890 6:165527543-165527565 ATTGGCCTGGTACTGGGCTTTGG + Intronic
1018799293 6:167210148-167210170 CCTGGCCTGCTTCTGGGCTAGGG - Intergenic
1018803789 6:167242974-167242996 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1019397574 7:830281-830303 CTTGGCATGAGCCTGGGCTTCGG + Intronic
1019870104 7:3752472-3752494 CTTGACTTGTTACTGAGCTTTGG + Intronic
1020396720 7:7725531-7725553 CTTGGCCTGTTACTGGGCTTTGG + Intronic
1020407457 7:7853874-7853896 CTTGTCTTGTTCCTGGTCTTAGG + Intronic
1020710352 7:11597642-11597664 CTTGGCCTGTTACTGGGCTTTGG + Intronic
1021988812 7:26122939-26122961 CTTGGCCTGTTACTGGGCCTTGG + Intergenic
1022078888 7:27000345-27000367 ATTGGCCTGTTACTGGGCTTTGG + Intergenic
1023555363 7:41416729-41416751 CTGGTCCTGTTTCTGAGCTTAGG + Intergenic
1024011967 7:45274957-45274979 CTTGTCTTGTTCCTGGTCTTAGG + Intergenic
1024040540 7:45550161-45550183 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1024454834 7:49593223-49593245 CATGGCCTTTAAATGGGCTTTGG + Intergenic
1024701667 7:51910279-51910301 ATTGGTCTGTTACTGGGCAGTGG + Intergenic
1024744209 7:52388460-52388482 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1024866106 7:53906360-53906382 CTTGGCTTGTTACTGGGCTTTGG + Intergenic
1024884340 7:54124638-54124660 CTTTGCCTATTACTGGGCTTTGG - Intergenic
1025718331 7:63984185-63984207 CTTGCTGTGTTACTGGGGTTGGG + Intergenic
1026046487 7:66909082-66909104 CTTCACTTATTACTGGGCTTTGG - Intergenic
1027685800 7:81277971-81277993 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1028043862 7:86091482-86091504 CTTGGCCTGTTACTAGGCTTTGG + Intergenic
1028141738 7:87282000-87282022 CTTGGCCTGTTATTGGGATTTGG + Intergenic
1028237823 7:88382837-88382859 CTTGGCCTATTACTGGGCTTTGG + Intergenic
1028935016 7:96455079-96455101 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1029222314 7:99000375-99000397 CTTGGCCTGTTACCCGGCTTTGG - Intronic
1030277460 7:107736130-107736152 CTTGGCCTGTTACTAGGCTTTGG + Intergenic
1030368756 7:108674043-108674065 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1030931285 7:115525667-115525689 CTTGGCCCATTACAGGGCTTTGG - Intergenic
1031236829 7:119188031-119188053 CTTGGCCTGTTACAGGGCTTTGG + Intergenic
1031676560 7:124618380-124618402 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1031832998 7:126650032-126650054 CTTGTCCCGTTACTGGGCTTTGG + Intronic
1032153103 7:129446942-129446964 CTTGGCCTGTTACTGGTCTTTGG - Intronic
1032923468 7:136576100-136576122 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1033076260 7:138253061-138253083 CTTGGCCTCTTACTGGGCTTTGG + Intergenic
1035378115 7:158420410-158420432 CTTTGTCTTTTCCTGGGCTTGGG + Intronic
1039324166 8:36466510-36466532 CTTGGCCTGTTGATGGGCTTTGG - Intergenic
1039539932 8:38357317-38357339 CTTGGCCTTTTTCTGGGCAATGG - Intronic
1040911947 8:52528433-52528455 CTTGGCGAGTTACTGGACCTTGG + Intergenic
1041292019 8:56317114-56317136 CTTGGCCTTACACTGGGCCTTGG + Intronic
1041934555 8:63321345-63321367 CTCGGCCTGTTACTGGACTTTGG + Intergenic
1041986184 8:63924488-63924510 CTTGGCCTGTCACTGGGCTTTGG + Intergenic
1043259969 8:78184178-78184200 CTTGACCTGGTACTGGGCTTTGG - Intergenic
1043315239 8:78912693-78912715 CTTGCCCTGTTCCTGATCTTGGG - Intergenic
1043517648 8:81010508-81010530 CTTGGCCTGTTACTTGTTTGAGG + Intronic
1044150801 8:88773090-88773112 CTTTGCCTGTTAGTGGACTTTGG + Intergenic
1044202392 8:89452503-89452525 CTTGGCCCATTACTGGGCTTTGG + Intergenic
1044285971 8:90412431-90412453 CTTGTTCTGCTACTGGGTTTTGG - Intergenic
1044633153 8:94298391-94298413 CTTGGCTTGTTACTGGACTTTGG - Intergenic
1045221841 8:100207080-100207102 CTTGGCCTGTTACTGGGCTTTGG + Intronic
1046064854 8:109184014-109184036 CCTGGCTTGTTACTGGGCTCTGG - Intergenic
1046128671 8:109941587-109941609 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1046197560 8:110884238-110884260 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1046417635 8:113937779-113937801 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1046585783 8:116147704-116147726 CTTGGCCTGTTACTGGGTTTTGG - Intergenic
1047654211 8:126958854-126958876 CTTGATCTGTTTCTGGGTTTTGG - Intergenic
1049100779 8:140577664-140577686 CTGGGCCTGTTTCTGGGCTCTGG - Intronic
1049238844 8:141526303-141526325 CTTGGCCTGGGACTGGGCACAGG - Intergenic
1050482677 9:6102618-6102640 CTTGGCCTATTACTGGGCTTTGG + Intergenic
1051791015 9:20802526-20802548 CTTGGACAGTTCTTGGGCTTTGG + Intronic
1051882149 9:21850677-21850699 CTTGGCCTGTTACTGGACTTTGG + Intronic
1052227592 9:26108391-26108413 CTTGGCCTGTTACTGGGCTTTGG + Intronic
1052368654 9:27640851-27640873 CTTGGCCTGTTACTAGGCTTTGG + Intergenic
1052561523 9:30089741-30089763 CTTGCCCTGTTACTGGGCTTTGG - Intergenic
1052614831 9:30824606-30824628 TATGGCCTGTTACTTGGATTGGG - Intergenic
1053293862 9:36899602-36899624 CTTGGGTAGTTTCTGGGCTTTGG - Intronic
1053781733 9:41616708-41616730 CTTTGCCTGTTACTGCCTTTGGG + Intergenic
1054169684 9:61826862-61826884 CTTTGCCTGTTACTGCCTTTGGG + Intergenic
1054667854 9:67753953-67753975 CTTTGCCTGTTACTGCCTTTGGG - Intergenic
1055903937 9:81271189-81271211 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1056092918 9:83221947-83221969 GCTGCCCTGCTACTGGGCTTGGG - Intergenic
1056156669 9:83845224-83845246 CTTGGCCTGTTACTGGGCTTTGG + Intronic
1056314232 9:85372930-85372952 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1056353869 9:85778303-85778325 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1056777337 9:89523074-89523096 CTTGTCCTGCTGCTGGCCTTGGG + Intergenic
1057454532 9:95196164-95196186 CTTGCCTTGTTTCTGGTCTTGGG + Intronic
1058019897 9:100076095-100076117 CTTGGCCTGTTAGTGAGCTTTGG + Intronic
1058259253 9:102809653-102809675 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1059196503 9:112375853-112375875 CTTAGCCTGTTACTGGGCTTTGG - Intergenic
1061173405 9:128976072-128976094 CTTGGCCTGTCAGAGTGCTTGGG + Intronic
1061976646 9:134071447-134071469 CTTGGACTGTTACTGGTCCGTGG - Intergenic
1186279498 X:7977133-7977155 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1186384091 X:9091747-9091769 CTTGGCCTGTTACTGGGCTTTGG - Intronic
1186469764 X:9812094-9812116 CTTGGCCTGTTACTGGGCTTTGG - Intronic
1187570546 X:20496352-20496374 CTTGGACTGGTACTGGTCTGTGG + Intergenic
1187604869 X:20871877-20871899 CTTGGCCTGTTACTGGGGTTTGG + Intergenic
1189154881 X:38746707-38746729 CTTGGCCTGTTACTGGGATTTGG - Intergenic
1189435387 X:40988272-40988294 CTTGTCCTGTTCCTGACCTTAGG - Intergenic
1190996746 X:55617468-55617490 TTTGACCTGTTACTGGGCTTTGG - Intergenic
1191095704 X:56671160-56671182 CTTGGCCTATTACTGGGCTTTGG - Intergenic
1191630035 X:63312574-63312596 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1191658802 X:63629792-63629814 CTTGGCTTGTTACTGGGCTGTGG - Intergenic
1191719238 X:64215695-64215717 CCTCGCCTGTTACTGGGCTTTGG - Intergenic
1191932928 X:66394177-66394199 TTTGGCCTGTTACTGGGCTTTGG + Intergenic
1191941258 X:66483851-66483873 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1192144545 X:68672808-68672830 CTCTTCCTGTTTCTGGGCTTGGG - Intronic
1192633912 X:72800806-72800828 CTGGGTCTGTTACTGGAGTTTGG + Intronic
1192647798 X:72919995-72920017 CTGGGTCTGTTACTGGAGTTTGG - Intronic
1192661561 X:73047748-73047770 CTTGGCATGTTACCAGGCTTTGG - Intergenic
1192673252 X:73168403-73168425 CTTGGCCTGTTACTAAGCATTGG - Intergenic
1192898706 X:75471923-75471945 CTTGGCCTATTACTGGGCTTTGG + Intronic
1193297784 X:79852687-79852709 CTTGGCCTGTTACTGGGGTTTGG + Intergenic
1193447158 X:81618784-81618806 CTTGGCCTATTACTGGACTTTGG + Intergenic
1193573667 X:83174918-83174940 CTTGGCCTGTTACTGAGCTTTGG - Intergenic
1193832950 X:86310110-86310132 CTTGACCTGTTACTGGGCTTTGG + Intronic
1193904488 X:87225844-87225866 CTTTGACTATTACTGGGCTTTGG + Intergenic
1193914799 X:87351915-87351937 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1193957287 X:87878223-87878245 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1194179588 X:90695922-90695944 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1194343312 X:92731097-92731119 GTTGGCCTGTTACTGCGCTTTGG + Intergenic
1194443553 X:93961116-93961138 CTTGGCCTGTTACTGGGCTTGGG + Intergenic
1194513415 X:94822239-94822261 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1194521083 X:94919452-94919474 CTTGACCTGTTACTAGGCCTTGG + Intergenic
1194604387 X:95961955-95961977 TTTGGCCTGTTACTGGGCTTTGG - Intergenic
1194833961 X:98658817-98658839 CTTGGCCTGTTACTGGGATTTGG + Intergenic
1194849243 X:98852161-98852183 CTTGGTCTGTTACTGGGCTTTGG - Intergenic
1195782350 X:108479852-108479874 CTTGGCCTGTTACTGGGCTTTGG - Intronic
1195824917 X:108989662-108989684 GTTGCAGTGTTACTGGGCTTGGG - Intergenic
1196135966 X:112209830-112209852 CTTGGACTGTTACTGGGCTTTGG - Intergenic
1197002292 X:121452937-121452959 CATGGTCTGTTACTGGGCCTTGG + Intergenic
1197044417 X:121978338-121978360 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1197045264 X:121989136-121989158 CTTGTCCTGTTCCTGATCTTAGG + Intergenic
1197097471 X:122612851-122612873 TTTGGCCTGTTACTGGGCTTTGG + Intergenic
1197379998 X:125727892-125727914 CTTAGCCTGTTACTGGGCTTAGG - Intergenic
1197405088 X:126039211-126039233 CTTGGCCTGTTACTGAGCTTTGG + Intergenic
1197409323 X:126096402-126096424 CATTGCCTGTTACTGAGCTTTGG - Intergenic
1197477356 X:126941316-126941338 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1197591868 X:128419400-128419422 CTTAGCCTGTTACTGGGCTTTGG + Intergenic
1198783037 X:140257784-140257806 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1199144439 X:144348952-144348974 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1199310424 X:146314387-146314409 CTTGGCCCGTTACTGGGCTTTGG - Intergenic
1200340492 X:155390629-155390651 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1200521273 Y:4212043-4212065 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1200526250 Y:4278091-4278113 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1200651670 Y:5847762-5847784 CTTGGCCTGTTACTGCGCTTTGG + Intergenic
1200746055 Y:6904859-6904881 CTTGGCTTATTACTGGGCTTTGG - Intergenic
1200973121 Y:9177697-9177719 CTTGGCCCATTACTGGGCTTTGG - Intergenic
1201248472 Y:12031034-12031056 CTTGGACTGTTTCTGGCCTGCGG - Intergenic
1201428306 Y:13878700-13878722 CTTTGCCTGTTACTGCCTTTGGG + Intergenic
1201529649 Y:14977881-14977903 TTTGGCCTATTACTGGGATTTGG - Intergenic
1201796626 Y:17903398-17903420 CCTGGCCCATTGCTGGGCTTTGG - Intergenic
1201804929 Y:18002587-18002609 CCTGGCCCATTGCTGGGCTTTGG + Intergenic
1202137957 Y:21686816-21686838 CTTGGCCCATTACTGGGCTTTGG + Intergenic
1202358011 Y:24072460-24072482 CTTGGCCCATTGCTGGGCTTTGG - Intergenic
1202512767 Y:25597653-25597675 CTTGGCCCATTGCTGGGCTTTGG + Intergenic