ID: 935185226

View in Genome Browser
Species Human (GRCh38)
Location 2:100725576-100725598
Sequence CCTGTTCACAGGACAGTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935185215_935185226 15 Left 935185215 2:100725538-100725560 CCCTCAGGAGCTTCTTACCCACA No data
Right 935185226 2:100725576-100725598 CCTGTTCACAGGACAGTGCCAGG No data
935185214_935185226 28 Left 935185214 2:100725525-100725547 CCAGCTGGGTTCTCCCTCAGGAG No data
Right 935185226 2:100725576-100725598 CCTGTTCACAGGACAGTGCCAGG No data
935185219_935185226 -2 Left 935185219 2:100725555-100725577 CCCACAGCAGGCCAGCCCAGGCC No data
Right 935185226 2:100725576-100725598 CCTGTTCACAGGACAGTGCCAGG No data
935185216_935185226 14 Left 935185216 2:100725539-100725561 CCTCAGGAGCTTCTTACCCACAG No data
Right 935185226 2:100725576-100725598 CCTGTTCACAGGACAGTGCCAGG No data
935185220_935185226 -3 Left 935185220 2:100725556-100725578 CCACAGCAGGCCAGCCCAGGCCT No data
Right 935185226 2:100725576-100725598 CCTGTTCACAGGACAGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935185226 Original CRISPR CCTGTTCACAGGACAGTGCC AGG Intergenic
No off target data available for this crispr