ID: 935188609

View in Genome Browser
Species Human (GRCh38)
Location 2:100757334-100757356
Sequence TCCCCAAAGCCCACCAGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935188602_935188609 29 Left 935188602 2:100757282-100757304 CCACCTACCTGAGAATCTGATTG No data
Right 935188609 2:100757334-100757356 TCCCCAAAGCCCACCAGGAGTGG No data
935188605_935188609 22 Left 935188605 2:100757289-100757311 CCTGAGAATCTGATTGGCACTCA No data
Right 935188609 2:100757334-100757356 TCCCCAAAGCCCACCAGGAGTGG No data
935188604_935188609 26 Left 935188604 2:100757285-100757307 CCTACCTGAGAATCTGATTGGCA No data
Right 935188609 2:100757334-100757356 TCCCCAAAGCCCACCAGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935188609 Original CRISPR TCCCCAAAGCCCACCAGGAG TGG Intergenic
No off target data available for this crispr